User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: S.purpurea purpurea f. heterophylla

  1. #1
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey all, I was wondering how do you tell if you have the f. Heterophylla form of Purpurea purpurea? I think, if I am remebering right, that Carl mazursaid to look at the growing point and if's it's green you've got one, he also said to see of the plant changes to other colors but green! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] Thanks all, BTW, would anyone like a picture of the plant that I think is heterophylla? Thanks! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  2. #2
    Guest
    Hi NepG [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] It would probably help if you could post a pic of your plant.. here is a pic of mine...

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well I think the easiest way would be to wait till it flowers. If it ain't purple then its heterophylla
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Sep 2001
    Location
    United Kingdom
    Posts
    2,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There are normal purpureas with yellow flowers, as the gene responsible for only the redness in the flower is absent.
    Put it in as much sun as possible. There should be no trace of red whatsoever.
    Alexis Vallance, U.K.
    Plant gallery
    Grow list

  5. #5

    Join Date
    Aug 2001
    Location
    UK
    Posts
    543
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,
    Just like Carl said, check the growth point. Any hint of red and it is not the f. heterophylla form. The plant in the photo definately is the plant in question.
    Best Regards

    Mike King

    NCCPG National collection holder of Sarracenia

    http://www.carnivorousplants.uk.com

  6. #6
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think it isn't it. Dagnabbit.. [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] I DID have a Heterophylla but it dried out on my and I lost it. Dangit. [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] Here a pic of it anyhow.
    [img]http://home.**********.com/nepenthesgracilis/Picture%20674.jpg[/img]
    Must just be light deprived. Too bad...I thought it had a Heterophylla. [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

  7. #7

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think that if they plant is damaged and it turns red it doesn't count as a heterophylla either.

Similar Threads

  1. S. purpurea heterophylla winner boglodyte $40
    By herenorthere in forum 2008 NASC Benefit Auction
    Replies: 25
    Last Post: 07-10-2008, 06:00 PM
  2. Soon to acquire Sarracenia purpurea ssp purpurea heterophylla
    By pedersonplants in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 11
    Last Post: 07-04-2007, 09:07 AM
  3. S. purpurea ssp. purpurea Heterophylla Winner schloaty
    By Bugweed in forum 2006 NASC Benefit Auction
    Replies: 26
    Last Post: 05-06-2007, 07:15 AM
  4. Some pics of S. Purpurea Purpurea, Northern Mass.
    By nelsap in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 3
    Last Post: 09-04-2006, 10:41 AM
  5. sarracenia purpurea ssp purpurea seeds for sase
    By Zero in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 05-02-2006, 08:08 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •