User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 8 12345 ... LastLast
Results 1 to 8 of 59

Thread: Tallest pitcher contest

  1. #1

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    After stumbling upon a picture of the famous gardenofeden flava in the cpukforum tallest pitcher contest, i decided we should have a contest too. There won't be any real prize (sorry i'm a cheap college student [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] ) other than the pride of knowing you have the tallest. You can post a picture of your prized plant if you like or you can just tell us how tall it is. So, what's your tallest pitcher of 2003??


    -buckeye

  2. #2

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ok, I'll start off. My tallest pitcher is 6 inches on a S. Wrigleyana. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] ( I really need to get some more Sarrs, somehow&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Yay, I'm winning the huge prize as of now!

    SF [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  3. #3

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My tallest pitcher so far for the year is from a PFT S. leucophylla "Red" at an approx. 18". I think it may be taller, but i don't want to overestimate. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] I'll measure it this weekend. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] And hopefully get a picture.
    Lithops care info: If you take care of it, it will die.

  4. #4

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh darn, there goes my prize! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] Vertigo, tripled the record already?!!??!

    SF [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  5. #5

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hehehe, don't worry, i'm sure i'll be handed the royal cp smackdown within a few minutes. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Man, can't wait to get a S. minor "Okee giant" [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    Lithops care info: If you take care of it, it will die.

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can already tell you who the winner of this contest will be but I am going to keep it a secret.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ha! I have you beat! 21" on my latest leuco red pitcher!

    **now waiting to get slammed by someone with one twice that size....** [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (schloaty @ Sep. 12 2003,1:25)
    Ha! I have you beat! 21" on my latest leuco red pitcher!

    **now waiting to get slammed by someone with one twice that size....** [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img][/QUOTE]
    Hehe, tell me about it. I can't wait to see what Sarracenia, Sarracenia0 and SarraceniaObsessed measure in at. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Wait until I get a ruler. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    How about widest mouth? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    Lithops care info: If you take care of it, it will die.

    Page 1 of 8 12345 ... LastLast

    Similar Threads

    1. Whats your tallest sarracenia pitcher
      By Kirkscoastalcarnivores in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 17
      Last Post: 10-31-2011, 01:09 PM
    2. Pitcher of the Month contest July-August 2010 contest voting
      By SirKristoff in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 2
      Last Post: 09-09-2010, 08:31 AM
    3. Pitcher of the Month contest April '10
      By SirKristoff in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 25
      Last Post: 05-01-2010, 03:38 PM
    4. Pitcher of the Month contest December 09
      By SirKristoff in forum Tropical Pitcher Plants  (Nepenthes)
      Replies: 1
      Last Post: 12-06-2009, 12:11 AM
    5. your tallest pitcher plant
      By matopis in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
      Replies: 21
      Last Post: 07-05-2008, 09:45 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •