User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: 1... 2... 3

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Two weeks ago I devided and repotted my S. lueco 'Tarnok' This morning I was watering and what should mine eyes see but 3 flower buds emerging!!! I can't wait until they open [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have tons of flowers popping up. Unfortunately, temps here are still below freezing. Hopefully the lack of sun in the garage won't have too negative of an impact, not to mention how I will move them all across the country in a month, without breaking any off.

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Hey! No fair! I don't have any yet! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Jan 2003
    Location
    Atlanta, Georgia (East Atlanta Village)
    Posts
    544
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Pyro,
    Yours' must be inside. Nothing on any of mine but they are all outside.
    I remain a man obsessed with a genus
    Brooks

  5. #5

    Join Date
    Jun 2002
    Posts
    191
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mine Sarrs are outside on the patio at 26*F as I write this. They're still in a deep sleep. They should start waking up about the second week of March.

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Sarraceniaobsessed @ Feb. 25 2003,10:12)
    Pyro,
    Yours' must be inside. Nothing on any of mine but they are all outside.[/QUOTE]
    Hey Obsessed,

    Nope [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] Mine are all outside on my patio. All my Sarrs are showing signs of growth in fact, now if only those 'FL giants' would kick in...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Jan 2003
    Location
    Atlanta, Georgia (East Atlanta Village)
    Posts
    544
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Pyro,
    Are yours in individual pots, perhaps black? Mine are in a large box like structure so the soil may have not warmed up enough to start growth. I keep looking EVERYDAY!
    I remain a man obsessed with a genus
    Brooks

  8. #8

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I love spring too, but where is it? Five below zero here today, and the snowbanks are still shoulder high and are now really just chunks of dirty ice sitting there, none of that fluffy white stuff for us. My plants are chaffing at the bit too, and want to grow. I am trying to forestall this as long as possible since I have no room to grow them inside. It's nice to know that somewhere there is the promise of spring!
    "Grow More, Share More"

  9. Page 1 of 2 12 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •