User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 17

Thread: S. leucophylla 'Tarnok'

  1. #9

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Tarnok flower...

    There's a tunnel at the end of the light...

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Is that your plant Dyflam?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes. I bought it last summer and this is the first flower I've seen.
    There's a tunnel at the end of the light...

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Are you seeing any pollen? Might you be willing to give it a bit of a whack to see if any falls?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'll give it a shot. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    There's a tunnel at the end of the light...

  6. #14

    Join Date
    Jan 2003
    Location
    Atlanta, Georgia (East Atlanta Village)
    Posts
    544
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    S. 'Tarnok' is reportedly a 'mule', sterile. I am not 100% on this.
    I remain a man obsessed with a genus
    Brooks

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Brooks,

    I had heard that in terms of the ovary because it is so grossly disfigured but no one I have talked to has ever checked to see if it actually sets pollen. They just assumed it didn't and since it is a cultivar no one was interested in trying to get seed from it anyway. I think it would be interesting to find out if the trait is heritable in hybrids. I am hoping Dyflam finds pollen but even if he doesn't I am not going to give up hope, I am guessing that if I ask enought people someone out there will find a clone that produces pollen thanks to a second mutation. (I can dream at any rate [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] )
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I saw no pollen, not your typical flower. [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    There's a tunnel at the end of the light...

Page 2 of 3 FirstFirst 123 LastLast

Similar Threads

  1. Any Harm in Letting a S. Leucophylla "Tarnok" Flower in Fall?
    By TENroaches in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 7
    Last Post: 04-10-2013, 01:43 PM
  2. My Tarnok isn't Doing at All Well. Help??
    By TENroaches in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 9
    Last Post: 10-15-2010, 10:45 AM
  3. 6" clump of S. Leucophylla "Tarnok" BigBella $60
    By cp-connection in forum 2009 NASC Benefit Auction
    Replies: 18
    Last Post: 05-15-2009, 09:33 PM
  4. Sarracenia leucophylla 'tarnok' Cynic81 $6
    By nepenthesmatt in forum 2008 NASC Benefit Auction
    Replies: 16
    Last Post: 08-01-2008, 04:35 PM
  5. S. leucophylla 'tarnok' flowering!
    By TunaSurprise in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 11
    Last Post: 02-07-2005, 07:55 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •