User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 17

Thread: S. leucophylla 'Tarnok'

  1. #1
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I got this plant from pft and in it does'nt say much difference between the typical plant . so what is the differnce ?

  2. #2
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I also wondered what the difference was! because I also got a bunch of "tarnocs" from the PFT sale..
    I found 2 web pages just now that indicate that the difference between Tarnoc and "typical" Leucophylla is that Tarnoc has double-petaled flowers!
    cool..but doesent mean a thing to me because I never let my sarracenia flower anyway! I dont care to have seed, so just like VFT's, my Sarrs never get to flower..I prefer all their energy to go into pitcher production..
    apart from the flowers, I dont know if there any difference between Tarnoc and Typical..
    scot

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Check out the 'Technical Question' post by me in this same forum. It has all the answers you need [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

  5. #5

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So the major difference is in the flower?
    There's a tunnel at the end of the light...

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I believe it is the only difference.

    I just wished someone could tell me the nature of the mutation LOL. Maybe this can be my thesis project...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah, it does seem interesting. Anyone know if hybrids of Tarnok plants ever show the mutation?

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Another question I am not getting answers to [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    I know the mutation effectivly destroys the ovary so the plants are infertile in that respect but no on seems able to tell me if it does or does not produce pollen. Since I have 3 flowers coming up I hope to be able to answer this question for myself.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 3 123 LastLast

Similar Threads

  1. Any Harm in Letting a S. Leucophylla "Tarnok" Flower in Fall?
    By TENroaches in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 7
    Last Post: 04-10-2013, 01:43 PM
  2. My Tarnok isn't Doing at All Well. Help??
    By TENroaches in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 9
    Last Post: 10-15-2010, 10:45 AM
  3. 6" clump of S. Leucophylla "Tarnok" BigBella $60
    By cp-connection in forum 2009 NASC Benefit Auction
    Replies: 18
    Last Post: 05-15-2009, 09:33 PM
  4. Sarracenia leucophylla 'tarnok' Cynic81 $6
    By nepenthesmatt in forum 2008 NASC Benefit Auction
    Replies: 16
    Last Post: 08-01-2008, 04:35 PM
  5. S. leucophylla 'tarnok' flowering!
    By TunaSurprise in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 11
    Last Post: 02-07-2005, 07:55 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •