User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: Cephalotus seedlings

  1. #1
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This seed was placed on a moist paper towel and put in the refrigerator for 3 months (31 October - 30 January) and then planted on the surface of peat and perlite. After 2 months, seedlings are now beginning to appear.


  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Do these seed require the cold stratification??
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I second Pyro's question....might explain why mine never germinated....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Peter D'Amato in Savage Garden recommends stratification, as does the ICPS Germination Guide at
    http://www.carnivorousplants.org/see...dgermguide.htm

    I am not sure whether it is actually necessary, but it seems to work.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •