User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: Heliamphora sp. yuruani tepui

  1. #1

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    [img]http://home.**********.com/users/vertigo/images/Heliamphora/H_sp_Yuruani_Tepui-1.jpg[/img]

    [img]http://home.**********.com/users/vertigo/images/Heliamphora/H_sp_Yuruani_Tepui-2.jpg[/img]

    [img]http://home.**********.com/users/vertigo/images/Heliamphora/H_sp_Yuruani_Tepui-3.jpg[/img]


    and my little heli tank. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    [img]http://home.**********.com/users/vertigo/images/Heliamphora/Heli-tank.jpg[/img]
    Lithops care info: If you take care of it, it will die.

  2. #2

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yuruani tepui? never heard of that before. I assume this is like a newly discovered/unidentified species right? anyway, cool plant! looks healthy. Hope it gets mature traps soon.

  3. #3

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can't look it up at work, but I am thinking it's not that new, and I am not sure why Andreas Wistuba has not named it yet.

    Joe

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    sp. "Yuruani tepui" was discovered and put into TC by the Japanese I believe (which could explain why Wistuba has not named it.) Odds are it is a H. minor form. If anyone has their hands on a mature plant I would love to see some photos.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Interestingly, the jeuvenile pitchers are very similar to the ionasii I got from Tony..... [img]http://www.**********.com/iB_html/non-cgi/emoticons/rock.gif[/img]

    Though with less color....My jeuvies are maroon.



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow! thats a beautiful plant It looks like it'll be even more beautiful when it gets a little bigger
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •