User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 7 of 10 FirstFirst ... 345678910 LastLast
Results 49 to 56 of 73

Thread: Poachers

  1. #49
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]You don't seem to want to read my comments. Making something rare, deliberately or not, gives it a premium value. This is my fundemental point.
    I have read every single word you have posted here. And I do understand what you are saying though I do not feel you really understand what I am saying. By using the word "making" you are implying deliberate intent on the part of ABG to keep these plants rare. That is not what tehy are doing at all. It is like Bugweed said:

    Quote Originally Posted by [b
    Quote[/b] ]I believe purp montana's should be more widely available to all who desire one, as so the Georgia leuc, if it is so important to some to have it. But, this is something that can only come of trust from those that are in charge. They have been burned by those who swore their love to the plants, and the love for the site, only to turn around to make money off the site. Can you blame them for being so gun shy?? They don't know who to trust, and too many folks only see dollar signs where these plants are concerned. We may have to move slow
    ABG has been burned. How do you think they felt when the GA oreo site was stripped bare and word got back to them that it was because someone involved in the conservation of the site (from a different institution) told a "trusted friend" where to find it? Which leads right into your next comment:

    Quote Originally Posted by [b
    Quote[/b] ]You worry about people trying to locate the site for themselves, or even disclose location information about it. Are you worried that someone might want to poach it?
    I know people are trying to find the sait. In the original GA leuco thread I made a post asking that if anyone for some reason knew the location of the site that they please not post it. As Ozzy and herenorthere have both mentioned, poachers don't go to sites because of the chance to get location data, they go to sites for convinence. A poacher in GA who learns of the GA leuco site will much rather go there than to FL or AL and if he does get to the site he will happily strip it bare because he can. And even if the GA leuco were being distributed among the community it would not stop a poacher from taking the plants.

    Quote Originally Posted by [b
    Quote[/b] ]Additionally, making material available is not a significant undertaking, as you imply. I highly doubt it would take any time or resources away from the conservation work. Stated simply, the effort to make these plants available to others is minimal;
    Making material available is not a significant undertaking if you are a major TC nursery and that is what you do. But you forget that ABG is not a major TC nursery and for them it is a major undertaking. The TC lab at ABG is not devoted to CPs (I have already stated this.) For them to make enought to enact some kind of distribution effort would probably require that they drop all their other TC projects. That just is not going to happen, the ABG does not exist solely to cater to the CP community.

    Quote Originally Posted by [b
    Quote[/b] ]I think you underestimate the ability of people in the cp community that you call the "obsessive hobbyist." Many of these people are involved in cultivation, and nature in general. Many aren't clouded in their judgements by having to obtain an income from these plants but, are involved in cp for a love of nature's wonders. There are a number of these people that you call, "obsessive hobbyists" that likely have more field experience than you could imagine. Their motivation? A passion for these plants and nature. That kind of devotion shouldn't be negated, nor underestimated.
    I do not and never have underestimated this community. But I also do not underestimate greed driving the tenacity of a poacher to rip every last plant out of the ground. It does not matter how many people love the plants, it does not change the fact that the poacher loves money more.

    Also, I do not believe I ever used the word "obsessive" and if I dod it was not in the negative context you are implying. I myself am rather obsessive so I would not use it in a derogatory manner.

    Quote Originally Posted by [b
    Quote[/b] ]I myself could care less about the inner workings of ABG, but know they work their butts off. I am behind them 100% in their efforts.
    Thanks Bug, I was beginning to feel like the only one.

    Quote Originally Posted by [b
    Quote[/b] ]That is why I have instigated the NASC, for all of us to have the location species we desire, and relieve the "poaching" burden off of some locations, reducing the money aspect that seems to drive too many hobbyists. Anyone who needs a plant, just ask.
    I know this and I fully support the NASC for these reasons

    Quote Originally Posted by [b
    Quote[/b] ]It will take time, effort, and work,
    I have said many times that patience is a virtue. Thank you again for backing me on that.

    Quote Originally Posted by [b
    Quote[/b] ]but with the people on these Forums, I think it can be done. Put in a good word for us (NASC), Pyro. We would like to help.
    I have and will continue to. But like you mentioned, ABG is very gun shy of who they deal with and because of this I work at their pace. But I am still working.

    Quote Originally Posted by [b
    Quote[/b] ]It would be nice if the ABG would propagate some Georgia leucs for us, but they see their role as being something else. And they do that something else very well.
    And thank you herenorthere. This encompases what I have been trying to get across. The ABG fill, and fulfills, the role it has set out for itself. And they do indeed do it well. It is a free country and you do not have to agree with what ABG does or how they do it but just because you do not agree does not mean that you are right and ABG is wrong.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #50
    Guest
    Quote Originally Posted by [b
    Quote[/b] (0zzy @ Oct. 17 2004,11:35)]While I agree that development is the biggest theat to cp's by far, we can't ignore or pretend that another threat don't exist. It does and I've seen the damage it caused. Poachers probably won't take the whole site. But they will take the biggest best looking plants. Greatly reducing the gene pool of that site.
    Ozzy, I think you and I can respectfully agree to disagree on many points but, I have to agree with your comments about the reduction of diversity by "selective" poaching. You made me think of plants like the leuco 'Tarnok,' antho-free jonesii, antho-free leuco, and most recently, antho-free alata. All, unique plants that were selectively removed from a site for introduction into cultivation. These sites no longer contain these unique plants, and the sites are now somehow deficient. I personally feel these plants should be in cultivation but, also feel remorse that they're no longer in the wild. In some way there should have been some kind of responsible collection of the material to place it in cultivation and keep it in the wild. That's another grey area (borrowing PDX's terms).
    I'm not going to bore the astute memebers of this list with my redundant comments on the GA leuco site. I think I've repeated myself enough times. I would like to state emphatically that my comments are not critical of the work of ABG or it's key people. I applaud their efforts in conservation including: the Roberta Case Preserve in AL, the purp montana site in GA, and the "infamous" leuco site in GA. My comments are simply objective questions. As any goal-oriented members of this list will attest, objective questioning is paramount to success. Objective questioning is a practice that even the key people at ABG should exercise in their efforts. Any implication of my comments, as being anything other than objective questioning, is an effort to misunderstand and/or distort my comments.
    Peace out, imduff

  3. #51

    Join Date
    Sep 2001
    Location
    California
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]You made me think of plants like the leuco 'Tarnok,' antho-free jonesii, antho-free leuco, and most recently, antho-free alata. All, unique plants that were selectively removed from a site for introduction into cultivation. These sites no longer contain these unique plants, and the sites are now somehow deficient.
    Hopefully, some plants with these unique traits were left in the wild at the time of the collection. That's primary difference between poaching and deterministic collecting.

  4. #52

    Join Date
    Dec 2003
    Location
    Martinez, California
    Posts
    3,556
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Carl Mazur did leave antho free alata in its place. The whole plant was not taken without the understanding to put it back in place. As long as its home is still there, the plant will continue in that spot, as that is an NASC goal. Only full removal under threat of annihilation. No other reason will suffice.
    45 yrs. growin\'
    Founder NASC

  5. #53
    Guest
    Quote Originally Posted by [b
    Quote[/b] (Bugweed @ Oct. 19 2004,2:16)]Carl Mazur did leave antho free alata in its place. The whole plant was not taken without the understanding to put it back in place. As long as its home is still there, the plant will continue in that spot, as that is an NASC goal. Only full removal under threat of annihilation. No other reason will suffice.
    Unfortunately Bugweed, I visited the site a couple of months ago and didn't see any. Although, the general condition of the site looked good.
    imduff

  6. #54

    Join Date
    Dec 2003
    Location
    Martinez, California
    Posts
    3,556
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Keep an eye on the site, Imduff. Let us know if it returns in the spring. If not, I will find out why. If I have to, I will send back the piece I have and place it back where it came from, and wait for another piece when it can be placed in cultivation.



    45 yrs. growin\'
    Founder NASC

  7. #55
    Guest
    This has always been such a "touchy" subject that will never be resolved to everyone's satisfaction. Responsible collection of material for cultivation from the wild. The field is a tremendous source of variability for plants in general, not just cp. I wonder how the orchid growers have resolved this issue. They seem to be years ahead of cp in handling most issues.
    Another thought, some might also argue that it isn't wise to re-introduce plants back to a site after it's been removed.
    imduff

  8. #56

    Join Date
    May 2004
    Location
    Portland
    Posts
    188
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Imduff,

    You make a good point mentioning responsible collection for cultivation. I think most can see there are 2 sides of this issue. There is flat-out poaching with no regard to anything but selling the plants asap to anyone who'll cut a check and then there is responsible collection with the end result being to get the plant into cultivation or as a last result to preserve the plant if in danger. I would tend to put the poacher in the realm of someone doing something for easy money. They could just as easily be poaching mushrooms or moss or even trilliums. It's just about cash money for easy work - they don't care what they dig up. I think any of us who love any type of plants can see that at one time someone somewhere "collected" a plant, in turn sharing it. When I think of responsible collection I think of someone removing a plant or two after weighing many factors - size of population, proper permission sought, whether or not the plant truly merits cultivation, and so on. I'm not saying specifically sarracenia but any plant. I think the sarracenia trade has come quite a ways from the anything goes days of the 1970's. One example where I think collection is truly at the level of poaching is in the area of arisaema. I can go on a website in China and "order" numerous plants which are then in turn collected from the wild. Do they have permission and have they weighed the factors and risks to the native populations? I don't know, but one night of research led me to decide not to order from them.

    I do think another can of worms is the issue of who truly can "field collect" a plant or two. I don't feel qualified to answer that being out on the West Coast therefore not really having a grasp of local plant populations. I have visited most of the darlingtonia sites here and have never really seen evidence of collecting.

    Just adding another $0.02 to the discussion.

Page 7 of 10 FirstFirst ... 345678910 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •