User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 8 of 10 FirstFirst ... 45678910 LastLast
Results 57 to 64 of 73

Thread: Poachers

  1. #57
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    OK, now I see something I completely disagree with. imduff said, "I wonder how the orchid growers have resolved this issue. They seem to be years ahead of cp in handling most issues." Nonsense! As one who has at least 5x more orchids than CPs, I feel qualified to say CP enthusiasts are miles ahead of orchid enthusiasts when it comes to conservation.

    Part of it might be that CPs appeal to a different kind of person. Part of it might be that many of us are familiar with some CP habitat. Part of it might be that many CPs are so easy to propagate that efforts like the S. alabamensis project and NASC are viable. But, whatever, the reason is, CP enthusiasts pay more attention to conservation issues.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  2. #58
    Guest
    Quote Originally Posted by [b
    Quote[/b] (herenorthere @ Oct. 20 2004,11:11)]OK, now I see something I completely disagree with. imduff said, "I wonder how the orchid growers have resolved this issue. They seem to be years ahead of cp in handling most issues." Nonsense! As one who has at least 5x more orchids than CPs, I feel qualified to say CP enthusiasts are miles ahead of orchid enthusiasts when it comes to conservation.
    Glad to hear your opinion. Taxonomy and cultivar registration for cp has come a long way in the last 5 years with the efforts of Jan Schluer (sp?). It is in it's infancy relative to orchids. With orchid cultivation having a much larger base of enthusiasts, how have orchid societies dealt with issues that are sensitive to cp societies, namely field collection?
    Are you familiar with the way orchid societies handle the issues of responsible collecting? How is it handled? regulated? Is there some level of acceptance or just strict reluctance?
    Thanks, imduff

  3. #59

    Join Date
    Oct 2004
    Posts
    1,379
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have learned a lot from reading this thread. Thank you to everyone who commented. My thoughts would be for anyone in a position to cultivate any CPs they can for the purpose of re-introducing them to their native range to do so. I would volunteer to try to germinate seed that would ultimately end up back where it belonged. Well, maybe after I get a little experience under my belt so that my odds of being able to contribute would be increased.

    We have a forest preserve in the local area that has CPs growing in it, S. purpurea to be exact. I know of a bog that has swamp orchids in it. The stewards don't even take most volunteers back to the site for fear of the potential of field collection. They are beautiful sites and now I am getting a better grasp on the mind set of some "collectors". Disgustingly selfserving comes to mind.

    And bugweed, I don't think you should send back the piece you have. Leave it be for a few years in a protected environment and consider allowing it to mature to the point wherein which divisions would be possible. Maybe you could transfer those divisions to people you trust and in about 5 years from now, all of those divisions could be replanted at the site of origin leaving the parent plants with responsible people to help insure the perpetuation of the species in its natural community. Please think of that one plant you have being sent back and some jerk plucking it out of the ground for a collection.

    I've read many comments here. This is merely my knee jerk opinion to what I have read. I apologize in advance if I have offended anyone. I believe these plants are our children's inheritance.

  4. #60

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was just reading an old issue of CPN, I think it was June 2001. There was a nice article in there on poaching. Perhaps it is more of a problem than I thought it to be. Also, interestingly, in the seed bank listing of that issue, there was S. leucophylla (Georgia, USA) seed listed as available.

  5. #61
    Guest
    I had forgotten about the accounts of that historical meeting. Interesting to read it again. The September issue of that same year lists S.alata Georgia, USA in the seedbank. There's no telling what was distributed.
    imduff

  6. #62
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (imduff @ Oct. 18 2004,7:59)]Any implication of my comments, as being anything other than objective questioning, is an effort to misunderstand and/or distort my comments.
    I rather resent that I am now being accused of intentionally distorting comments.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #63

    Join Date
    Dec 2003
    Location
    Martinez, California
    Posts
    3,556
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry, Pyro, but I don't think you need to take this personally. I do not believe that this was in any way directed specifically towards you. Be objective, not emotional.
    45 yrs. growin\'
    Founder NASC

  8. #64
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ] I do not believe that this was in any way directed specifically towards you. Be objective, not emotional.
    Bug, he is be objective.... He objects to being treated as such.... sorry...couldn't miss the opportunity...



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 8 of 10 FirstFirst ... 45678910 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •