User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 16 of 16

Thread: Mites on ym ball pythons

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Never, never, never spray any mite killer directly on an animal. That is the surest way to cause them serious harm.

    Simple solution:

    Get some Sawyer's Insect Repellant Clothing spray, it is identical to PAM and is actually produced and distributed legally (which cannot be said of PAM)

    Get a rag and spray it well per the directions then let it dry. Toss it in a plastic container and then put the snake in overnight. While the snake is in there, tear the cage down completely, wash with water then a 10% bleach solution. Dry and then spray with the Sawyer's inside and out and let dry completely. Also spray every thing that is going back into the cage and let those dry completely. The only thing you should not spray is the water bowls. Those you run through the dishwasher on high heat (I usually do it twice) and then stick them in an oven @ 300F for at least one hour, you can also add the "decor" items to the oven too, but I would do that before spraying them.

    Things to remember; the rag and plastic container need to be the right size for your snake. Do not use something like a small washcloth for an adult ball. Like wise do not use a 41Q tub for a hatchling. I generally use part or all of an old t-shirt and and appropriate sized deli cup/dish (those come anywhere from 10cm to 45cm across)

    If you cannot find Sawyer's then I suggest you contact: markusjayne@ballpython.ca

    He is a Canadian ball python breeder, very wel known, and he can probably point you in the direction of something up there that works.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    Charlatan lizasaur's Avatar
    Join Date
    Apr 2010
    Location
    Florida
    Posts
    2,002
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    May I ask what your credentials are? I mean, I'm just curious, with your holier-than-thou attitude in regards to snake keeping. This is twice now that you've come by and said that I, everything I know, and everyone I've spoken to, are entirely, ***-backwards, wrong. You've either something against me, or you just don't know how to share your opinion in a more respective tone.
    Whenever I have a question, I consult the snakecommunity. There's keepers all around the world, some of which have literally hundreds of snakes. There's a herpetologist, even, that works with hots. You're going to say that a collection of responsible keepers with invaluable experience on all aspects, are wrong, just because YOU say so?
    I'm not saying I know it all. I'm just saying that after 9+ years, learning from my errors, listening to vast and varying opinions, and reading a few books, I have a slight clue as to what I'm doing.
    Yes, ball pythons don't require a ton of space, but like you said, it's all relative to size, and her enclosure is just the right size for her. I would NEVER, let her get too cold, or too warm, or too dry. She never goes without fresh, spring water, or has to sit in a dirty cage for more than a couple hours after voiding. She's never regurged, never had an RI. No one, in all my time, has ever said jack about how I keep my snakes, and her vet has approved my set up. Do you think I'm a FOOL, that I don't honestly have the appropriate temperature gradient in the enclosure? I do, and she's just a big girl with a big appetite, and her aggressive feeding response was little more than her telling me she's not getting enough. Upon feeding her a small rat in addition to a large, she's no longer crabby at feeding time, which was the ONLY time she's shown even a hint of aggression. Her side-laying behavior is unusual, which is why I ASKED about it, but no one, including the vet, or yourself, has any explanation for it, and it's been deemed as non-life threatening. And for the record, I did, in fact, get mites from the bedding. It has happened to Sheba's prospective owners, and to a few people in the forum that I primarily go to. It happens; don't ask me how or why, but it does, and I'm not the only one. Sheba is a solitary snake and did not have mites for the few months I had her after bringing her home, and in that time, she hadn't even seen another reptile.

    I didn't say anyone was wrong; or that I was absolute. I shared what I did, which is what, down to the product, the majority of the keepers recommended. And you know something? She's not dead. She's not ill, or inept, and her mites were gone in a couple of weeks. So I obviously did something right.
    Last edited by lizasaur; 07-03-2010 at 11:04 AM.

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmmm... Someone has a chip on their shoulder.

    Take a breath and I will address this point by point

    Quote Originally Posted by i<3carnivores View Post
    May I ask what your credentials are? I mean, I'm just curious, with your holier-than-thou attitude in regards to snake keeping.
    My attitude is not "holier-than-thou", my attitude is confidence which you have erroneously mistaken for arrogance.

    As for my credentials; I have been keeping herps for 28 years. I have kept dozens of species in that time. To the best of my knowledge I hold the record longevity for a Banded Gecko. My collection is small right now (4 balls, 3 Phyllomedusa sauvagei, 1 corn, 1 grey banded king, and 1 chondro) but there have been times where the numbers were significant (I had over 100 garters for a coule years.) I also have a BS and a PhD in biological sciences and, while that is not exactly relevant to keeping per say, a well informed background on how biology works and all that does contribute to a greater understanding when you are a keeper.

    This is twice now that you've come by and said that I, everything I know, and everyone I've spoken to, are entirely, ***-backwards, wrong. You've either something against me, or you just don't know how to share your opinion in a more respective tone.
    I have nothing against you but I do have something against information that is in error.

    As far as "respective tones"... As I said above, you mistook my tone. Not a lot I can do about that. After reading your reply, I suggest you heed your own advice though.

    Whenever I have a question, I consult the snakecommunity. There's keepers all around the world, some of which have literally hundreds of snakes. There's a herpetologist, even, that works with hots. You're going to say that a collection of responsible keepers with invaluable experience on all aspects, are wrong, just because YOU say so?
    I did say that the information you are relaying is in error. Maybe you were misinformed, maybe you misunderstood. I know all about the snake community, I am part of it as well and I participate in many forums in the circles. I know many keepers as well, from the small hobby guys all the way up to some of the big boys with the "hundreds of snakes" that you talk about. Heck, I live less than an hour from one of the largest ball python breeders out there and I visit his place pretty regularly. I know more than a few hot keepers and have a long standing relationship with the herp vet for Zoo Atlanta and the Atlanta Botanical Gardens.

    From all those sources and more, I put forth the information that I have. You do not like that it contradicts what you had to say? Fine. But I am coming from a place of experience, whether you choose to recognize that or not.

    I'm not saying I know it all. I'm just saying that after 9+ years, learning from my errors, listening to vast and varying opinions, and reading a few books, I have a slight clue as to what I'm doing.
    I never said you were clueless. I just put forth that some of your information was off. You used PAM, you love PAM, and you say all your contacts recommend PAM. I have heard enough horror stories involving PAM that I will never be using it. And I also know for a fact that any other product with the same active ingredient as PAM specifically say not to have direct contact with the solubile agent (which is regulated by the FDA) so using a product that advocates spraying it on an affected animal is, without question, not an good idea.

    Her side-laying behavior is unusual, which is why I ASKED about it, but no one, including the vet, or yourself, has any explanation for it, and it's been deemed as non-life threatening.
    Obviously you did not bother to follow that link I put up in the other thread because the behavior you described was explained right there as plain as day:

    Laying Inverted

    This is another good sign! Chances are you will catch your female laying inverted. Although quite common, it isn't a sure sign of eventual ovulation. I've seen some of my males laying inverted on occasion. Usually after they have bred for 24 hours!!! Go figure!
    I can provide you with the opportunity to expand your knowledge but if you chose to ignore said information there is nothing more I can do on the matter

    And for the record, I did, in fact, get mites from the bedding.
    It has happened to Sheba's prospective owners, and to a few people in the forum that I primarily go to. It happens; don't ask me how or why, but it does, and I'm not the only one.

    Perhaps I mis-spoke there and for that I apologize. It is possible for bedding to act as a vector for mites, I grant that and I should have been clear. But the point is the same that mite come from other infected animals. If it is that there are mite ridden animals at the same pet store that is selling the bedding, or from bringing a new animal home from an expo.

    I didn't say anyone was wrong;
    You kinda did accuse me of being wrong...

    I shared what I did, which is what, down to the product, the majority of the keepers recommended.
    And I shared what I did, down to the product, which is what I, in 28 years of keeping and maintaining communications with many varied people in the herp community have found to be the safest and most effective. I disagree that the majority of keepers recommend PAM, but I would believe that the majority of keepers you communicate with recommend it. There is a difference.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    Charlatan lizasaur's Avatar
    Join Date
    Apr 2010
    Location
    Florida
    Posts
    2,002
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's not a chip on a shoulder, just pure stress, and your "misinterpreted" remark was the last thing I needed. I should've taken a breath, and I was wrong to not express myself better, and for letting other circumstances cloud my judgment.
    You have more years and a degree on me, and while that's impressive, it doesn't cancel out my 9 years, or the two years of reading I did prior. Or the endless conversations with my vet, and guidance of my own veteran keepers, or newbs that've learned from their mistakes.
    I feel this is more like a disagreement on opinions, like feeding live over f/t, or newspaper over aspen or coconut. Your way isn't the only way, and if I received no consequences and achieved desired results, it's not fair for to say I was totally wrong.
    I read the label, I know the risks PAM carries. It's primary use is to be used in the container. The label says it could be used on the reptile, but with extreme caution, and it's a risk I didn't bother with, and advised the OP not to take, either. Any horror stories with PAM are, I imagine, because those people failed to use it as directed, and it is their own fault. That's about as good as blaming the game, not the player. Or my favorite, like those people that put their hands in gator's mouths, and blame the gator for biting them.
    However, for direct-snake treatment, I used Reptile Relief, which is made by Natural Chemistry, and is safe for direct use on reptiles. It was recommended second to PAM, and I couldn't find any horror stories or reasons why using it on my snake would be a bad idea. In theory, I didn't even have to use PAM, since it can be used in the tank, as well.
    Obviously, I did follow up your link, and it didn't resolve anything. Your link is for breeding snakes, and Sheba, as far as I know, is pure. If she had mated prior to coming into my possession, then all of that should've happened the first year I got her. She never experienced breeding temps, nor has an egg-laying container. The only way your link and the information on it is relevant is if they can hold on to sperm for years after mating, deciding when to use it. Even if that were the case, she's not kept in ideal breeding conditions, so a further mystery would be "why now?".
    Your explanation for the bedding is reasonable, and I accept that. Pet stores get reptiles in from questionable conditions, often bearing parasites or disease, and they keep the bedding right next to the animal display because that's the "reptile area" of the store. It would also explain why I've never had a problem since ordering online from a company that doesn't have live animals.

    I didn't say you were wrong in your treatment method. I said you were wrong for coming in and saying everyone else was. Was my treatment riskier than yours? Evidently. But then again, that's why there's directions and personal advisement.
    It's odd that it worked out that way, that I ended up on a forum where the majority of people said PAM and no one said "Anything but PAM!", but it makes sense, I guess. My bad for not being clear on that.
    Last edited by lizasaur; 07-04-2010 at 05:37 PM.

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by i<3carnivores View Post
    You have more years and a degree on me, and while that's impressive, it doesn't cancel out my 9 years, or the two years of reading I did prior. Or the endless conversations with my vet, and guidance of my own veteran keepers, or newbs that've learned from their mistakes.
    Again, I was not saying your years count for nothing. I will posit one thing though, sometimes a small amount of high quality information does more than an massive quantity of mediocre information. Obviously I do not know what forums you are using but I have been through many in my days and have stopped using many of them because they are full of the mediocre and lacking on the quality. And that goes for some forums that are considered to be the "pinnacle" for that subset of the herp community.

    Also, and I say this with no malice intended, vets can and often are wrong, especially when it comes to herps. A real, serious, herp vet is extremely difficult to come by. Heck, a competent dog vet is hard to find (do not even ask me about why I am looking for a new vet right now for my dogs.) I will address this further below.

    I read the label, I know the risks PAM carries. It's primary use is to be used in the container. The label says it could be used on the reptile, but with extreme caution, and it's a risk I didn't bother with, and advised the OP not to take, either.
    See there is the thing: the labels says it can be used on the reptile. As I said above, any other product carrying permethrin says explicitly not to allow direct contact. Ever. The stuff is massively toxic. So the fact that PAM says it is okay to do so is reprehensible to me. Which leads me to your next comment...

    Any horror stories with PAM are, I imagine, because those people failed to use it as directed, and it is their own fault. That's about as good as blaming the game, not the player. Or my favorite, like those people that put their hands in gator's mouths, and blame the gator for biting them.
    The horror stories are from people that are following the directions; directions that say it is acceptable to spray a massively toxic compound on an animal. That is not blaming the game.

    Obviously, I did follow up your link, and it didn't resolve anything. Your link is for breeding snakes, and Sheba, as far as I know, is pure. If she had mated prior to coming into my possession, then all of that should've happened the first year I got her. She never experienced breeding temps, nor has an egg-laying container. The only way your link and the information on it is relevant is if they can hold on to sperm for years after mating, deciding when to use it. Even if that were the case, she's not kept in ideal breeding conditions, so a further mystery would be "why now?".
    Just some observations here:

    Obviously, I did follow up your link, and it didn't resolve anything. Your link is for breeding snakes, and Sheba, as far as I know, is pure.
    --Yes, my link is in reference to breeding snakes. However laying inverted is not exclusive to breeding which is implied in the blurb but I can see how it might not be obvious.

    She never experienced breeding temps... Even if that were the case, she's not kept in ideal breeding conditions, so a further mystery would be "why now?".
    --The whole idea that cycling is necessary for balls is a bit overblown. Some major breeders keep their animals at a constant temp year round and breed their animals just fine. As for the "why now" there could be any number of explanations.

    nor has an egg-laying container.
    --Balls do not need an egg-laying container. Personally I have never heard of any ball breeder using one.

    The only way your link and the information on it is relevant is if they can hold on to sperm for years after mating, deciding when to use it.
    --Ball pythons can and do retain sperm. I can point you to a few interesting threads on that if you would like.

    Obviously, I did follow up your link, and it didn't resolve anything. Your link is for breeding snakes, and Sheba, as far as I know, is pure.
    --I want to return to this. Before, you said your vet told you her behavior was because she was going to slug out. This goes back to what I said above about vets being wrong. A ball cannot slug out without being bred. You were willing to accept the vet was right because he was a vet. But, if Sheba is "pure" then there is no way she could be slugging out. So your vet was wrong. I am not saying this makes him a bad vet, just that he is uninformed. I do not like that he would put forth the incorrect information which he probably got from a quick net search. In my opinion if a vet does not have the answer then they should just man up and say so.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14
    Charlatan lizasaur's Avatar
    Join Date
    Apr 2010
    Location
    Florida
    Posts
    2,002
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My vet wasn't the one who said she was slugging, and that it's normal; it was the breeders that she'll be going on loan to while I'm in school.
    My vet said he could find no reason for it and that she was perfectly healthy. We even did a fecal, which came out clean. I was cross check any diagnosis he gives, and he's yet to be obviously wrong. I will say, that I believe he is one of those herp vets. He helped in the making of Dr. Rossi's book "What's Wrong With My Snake?"; of course, for all I know, that book is entirely wrong too and it doesn't make a lick of difference
    See, to you, that's totally negligent. For me, saying that you can but it carries great risk is acceptable to me. It can be used on the snake, but only if you're exactly 12" away from the reptile and it's a full moon and you're touching your nose with your tongue. What it comes down, for me is, they acknowledge the risk, and that it's primary use is NOT for the reptile. IF you're going to go ahead and take that risk, then it's no one's fault but your own if things don't end well. I liken it to sky-diving or playing Russian roulette. You could be either lucky, or very unlucky. It's a matter of opinion, and you can emphasize and reword your thoughts on it as many times as you want, my view is not going to change.
    Any information on any subject matter, should be obvious, and not merely implied. You're free to go into further detail on other reasons of laying inverted.
    Sheba has stopped laying inverted, though, and I'm not feeling any bumps in her abdomen. She's also not exceptionally bulky.

    And to change up the tune, I'm curious as to how the OP is doing. An update would be nice.

  7. #15
    Devon's Avatar
    Join Date
    Apr 2009
    Location
    Ottawa, Ontario, Canada
    Posts
    1,945
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello there everyone, I'm so sorry I didn't pay much attention to this thread after all. Please forgive me.

    I went to a trusted zoo/pet store and they gave me their special solution and it solved the problem. The mites have been gone for a few months now and my snakes are healthy and happy. I'm sorry to have wasted your time with this thread. But thankyou so much for all of your support, it's highly appreciated.

  8. #16
    Charlatan lizasaur's Avatar
    Join Date
    Apr 2010
    Location
    Florida
    Posts
    2,002
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sweet! Awesome news, glad it worked out!

Page 2 of 2 FirstFirst 12

Similar Threads

  1. Ball pythons?
    By Devon in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 10
    Last Post: 08-03-2009, 08:33 PM
  2. 11 months old Ball Pythons for trade
    By JB_OrchidGuy in forum Carnivorous Plant Trading Post
    Replies: 8
    Last Post: 06-01-2008, 04:16 AM
  3. ball python
    By CNCreefer in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 0
    Last Post: 09-19-2007, 08:29 PM
  4. Ball of nerves...
    By schloaty in forum General Discussions
    Replies: 24
    Last Post: 11-27-2006, 02:44 PM
  5. Ball python
    By Tim in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 8
    Last Post: 03-08-2003, 07:03 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •