User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 7 FirstFirst 123456 ... LastLast
Results 9 to 16 of 54

Thread: Pets you own

  1. #9
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh, I used to have so many cichlids, I especially miss the Electric Blue and the cutey Discus fish [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    So this is what I currently have

    Scorpions:
    (2) Desert Hairy (Hadrurus arizonensis)

    Tarantulas:
    (1) Mexican Blond (Aphonopelma chalcodes) I'm willing to trade this guy [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    (1) Curly Hair (Brachypelma albopilosum)
    (1) Chilean Rose (Grammostola rosea )
    (1) Mexican Red Knee (Brachypelma smithii)
    (2) Greenbottle Blue (Chromatopelma cyanopubescens )
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  2. #10

    Join Date
    Jun 2002
    Location
    washington state
    Posts
    98
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i have

    bay area blonde tarantula (aphonopelma iodium)
    a tarantula from LK Havasu Arizona (aphonopelma sp.)
    camaroon rusty red baboon spider (hysterocrates gigas)
    dwarf pufferfish (tetraodon transvalicus?)
    a catfish and a flounder
    african giant tailless whipscorpions (damon variegatus)

    i used to have over 40 tarantulas of several species, poecilotheria being my favorite. i also had several different species of giant centipedes (scolopendra subspnipes, gigantea, polymorpha and another one i think)
    i also had vinegaroons (mastigoproctus gigantea) i think thats the scientific name...
    through understanding of our differences, we will find respect for one another. we are all flesh and blood. i am not affraid to speak my mind. no matter the consequences, stay true to yourself. through the humble eyes of a child, we will realize true equality.

  3. #11

    Join Date
    Feb 2002
    Location
    z11 Puerto Rico
    Posts
    507
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    3 toed box turtle
    cockatiel
    Edward's lori

    Jœl
    http://homepage.mac.com/mindmaze128/...lood forum.jpg
    Joel Martínez
    San Juan, Puerto Rico, USA

  4. #12

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    oh yeah and I have a 14 year old cockatiel [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  5. #13

    Join Date
    Aug 2002
    Location
    Richmond Hill, Ontario, Canada
    Posts
    340
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow... such a broad variety of pets...

    Other than my CP's, I keep a dwarf hamster.
    Originally, the store sold them as Syberian Dwarfs but I think mine's a Campbell's/Russian Dwarf.

    My girlfriend wants to get a Welsh Corgi (though I'd prefer a Norwegian Buhund).

    And I was recently thinking of a Chinchilla (though they're pretty rare up here in the north). [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] Don't tell my girlfriend, she doesn't know yet.
    DOH!

  6. #14
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    1 betta
    1 iguana
    1 cat

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    1 red doberman with normal ears that is afraid of her own shadow

    1 torti cat that comes when called

    1 4' albino corn snake that is 12 years old

    1 Tucson banded gecko that is 13 years old (I think he is a captive age record)

    1 Savanah monitor that is evil in every way

    1 opposum that isn't really a pet but likes to come and visit when we are on the porch.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    other pets i have at my other house is a doberman pinsher that forgot his own tricks , he used to sit and shake hands but now he is a dumb dog that is too highper but I don't mind . A terrier mix that is very shy and runs away from his leash . Two identical cats . I had alot of pets that i can't name . Hey , has anybody ever heard of a mynah bird because i've been trying to look for one that is at least 2 months old , I'm trying to buy one but they are at least 800 bucks .

Page 2 of 7 FirstFirst 123456 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •