User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Albino corn snake

  1. #1

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

  2. #2

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow, that's one awsome alamanistic corn, and huge too! It has to be as thick as her wrist [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  3. #3

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It's an escape artist, and grows like a weed.

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Tim,

    I know exactly how you feel. Have you tried giving it a shoe/box/pot to hide in? Mine wouldn't stop escaping until I gave it a good hiding space.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have no knowledge about snakes so pardon the dumb question...but...I thought albino meant absence of pigment, but your snake obviously has "color" since you can see a pattern. Is albino just a figure of speech? Does it have red eyes?

    Suzanne
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm not sure, I'll let one of the experts answer you.

  7. #7
    Carcey
    Guest
    Hey Suzanne!
    Reptiles are unlike mammals as far as albanism goes. The genes for color in mammals are located on one chromosome, so if you have an albino gene, you're albino for all color traits. Reptiles, on the other hand, have their color genes on three different chromosomes, so they can be albino for red, brown/black, or yellows.....seperately. I know, it gets confusing. I used to raise corn snakes and figuring the genetics could be a NIGHTMARE!!! take care!!!

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •