User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 5 FirstFirst 12345 LastLast
Results 17 to 24 of 38

Thread: Grey tree frogletts

  1. #17

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Albino eyes are blueish or silverish because the structure of the eye refracts light like a crystal, just like albino birds that have green gloss or your snakes with yellow patterns from scail modification, or anoals that are bright blue and stuff, but yah, I think I just have a diluted one. Okay, so they have had 2 fruit flies vanish... a month on one tail? Mine don't even HAVE tails at this point, it only takes them like 48 hours after leaving the water to loose them.

    I have been giving them fruitflies wich are about the size of the frogletts eyeballs, is that about right? I did have 10 live in with my 3 oldest, but they all died o_O I added one remaining from my vial and got an aphid coverd plant, some leaf hoppers about the size of the fruitflies and two katydids twice the size of the fruitflies. What would help stimulate their eating? Are my sizes about right? Thanks [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    P.S. I have 13 frogletts at this point, yay!
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  2. #18

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sounds like oyu are off to a good start. It is important that they are not without food at ALL times for 8 weeks. NEVER let them run out of food. This seems to be crucial when raising froglets, and they do much better and get a better start when doing this.

    Flies the size of the eyeball sounds right. I would also try springtails, and maybe to find some snail eggs and hatch and feed the baby snails to them [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

  3. #19

    Join Date
    Oct 2003
    Posts
    1,211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    baby sowbugs work well. Just catch either a large female or look around carefully amongst adults.
    1 Nxventrata

    D. muscipula & D. muscipula 'Red Dragon'(barely)

    Sarracenia leucophylla(seedling)

    S. purpurea and Drosera filiformis filiformis/ intermedia seeds waiting to sprout.

    Drosera capensis

  4. #20

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Okay, thanks [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] AT the moment my frogs are in terrariums with white wet pater towl on the bottom, a lump of papertowle to hide in and sit on in the middle and a plant growing out of a plastic baggie, specifically lamb's quarters. Is this a good way to go or should I try and sterilise some dirt for them? Do I need more plants, color? I just added a cap of fruit fly larva and goo with another cap with a hole in it on top so they have a little fruit fly fountain and the wandering fruitfly larva stages boop about the terrarium. Is that good? Should I have more plants, rocks dirt, sticks? I want them to stay highgenic, but with 3 of them only eating 2 fruit flies in 4 days I get worried.

    Edit: Springtails are rare around here and most of our native snails are endangerd so I can't risk feeding them so I'll be trying for some isopods (sow bugs)... are aphids too small then and all of mine seem to have vanished, but weather it was into the frogs or not I do not know.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Darcie @ June 30 2004,9:35)]Albino eyes are blueish or silverish because the structure of the eye refracts light like a crystal, just like albino birds that have green gloss or your snakes with yellow patterns from scail modification, or anoals that are bright blue and stuff
    No, Darcie, albino eyes are red/pink because there is no pigment in them. The blue/silver eyes indicates a lack of dark pigment, hence the reason babies have blue eyes their pigment cells are not functional until some time after birth, this is the same reason babies don't have freckles. The default pigment for eyes is blue/silver, the structure of the eye has nothing to do with it. The reason my snake has yellow and orange is because there are multiple pigment processes in snakes (and many other organisms.) He lacks the dark pigments that normally make corn snakes grey, black, brown, etc with dark eyes but he still has the yellow/orange pigments. There are reciprical mutants that lack the yellow/orange pigmants but still retain the grey, black, brown.


    Back to your frogs. When I said they could live for a month off their tails I did not mean that the tail would stick around that long. I meant that the energy the derive from adsorbing their tails can sustain them for a month. Kind of like the hump on a camel.

    Now for the housing of the beasties. I have always been a naturalist with my pets and believe that captive animals do better when they are in someplace that mimics the wild. I would suggest a total overhaul on your set up. Here is what I would do:

    Take a ten gallon tank and get a piece of plexi-glass cut to fit the top. Now measure it along the long axis, mark the half way point and then cut. Tape the pieces back together creating a hinge (duct tape is best for this but it is rather ugly.) Now tape the taped together plexi and set it on the top of the tank and tape the remaining three sides of one half to the tank with clear packing tape. You now havea top that hinges open. Now take the tank and stand it on end and you have a hinged front plate that swings down from the top.

    For the next step, take some silicon caulk (you can buy it at a pet store) and use it to glue some plastic aquarium plants to the celing of the tank. I prefer to use natural coloured ones, again for the realism aspect. Because gravity will be woring against you I suggest that you flip the tank 180 so that the top is now the bottom. You will have to wait for the caulk to dry 24 hours before moving on.

    After the caulk is dry flip the tank back up and place a couple inches of moist fine coir or peat in the bottom. Add some rocks and bark and leaves for decoration/hiding places and maybe a small dish of water. Now toss your froglettes in and some food stuff for them and use a piece of dogeared tape to hold the top in place.

    The reason I like this kind of set up is because it gives the frogs what they want. Grey's (like all treefrogs) are arborial and like to have a lot of vertical distance to move around. The plants hanging fromthe celing will give them something to climb on and hang from and hide in and hunt in. And if they really wnat to hang out on the bottom of the tank there are places to hind there too. You have easy access to the tank through the top hinged segment and if you rotate the tank 90 it hides that part from view (if you are really offended by the tape everywhere.) I like to mist every couple days to keep humidity high.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yah, that is how I would do an adult tank, I like the idea of attaching the plants at the top I haven't seen that, but for the babies this seems okay, I think I will add more plants... grey tree frogs are not as into living up high as other tree frogs, that is to say they live in shrubs and stuff, mine actually hang out around mid level of the tanks the most often.

    I see what your getting at. I think my definition is more narrow then yours. Although, Albinoism is specfically a gene that sits on the production of melanin, so other color influencing protiens and crystal deposists are not affected. However, you should know that human eyes ARE blueish silver in true human albinos because of the chrystalin structure of the protiens. This structure masks the blood vessles and causes the eyes to look a hauntingly light silver blue. We studied this specifically in my genetics class and I personally know 4 true human albinos and all 4 have those silver grey-blue eyes. Blue is not a true pigment so that is why a hint of it shows threw. Darker blue eyes come from the combo of diluted pigments in combo with the structural elements. Felines also share this blueish look to their eyes when albino.

    Edit: When you were talking about bedding you ment the cork bark stuff they sell for herps right?

    I'm having trouble finding insects to feed my frogs, does anyone have any sugested places to look for them. It seems their are plenty of big preditory critters about, but even leaf hoppers are scarce right now :P
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  7. #23
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    An albino has pigment cells but lacks pigment in the cells. There are pigmant cells in the eye and for they eye to be blue there has to be pigment in the cell. Like I said it is a default colour. If someone looks albino yet has blue eyes they are not then albino by definition because their pigment cells contain some pigment.

    The phenotype you describe where the eyes are blue or pale grey is called leucopathy or hypopigmentation. The organism still has pigment in its pigment cells it is just that the pigment is either blocked in its processing cascade or produced at too low a level to cause colouration of the organism.

    An excellen example of this is the white alligators at the Audubon Zoo pictured here they in fact are not, as most people assume, albinos, because their eyes are brilliantly blue.

    There are however true albino alligators like this guy here. Note that his eye is pink.

    The only physical difference between the two is their eye colour. Genetically they are totally distinct creatures and only the latter can be classified as albino


    And back to the frogs again. Your best bet for getting them food stuff is to flip up a rock and just dig up all the small things that you find there. Toss them in and let the frogs go to work.



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #24

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    managed to scrounge up some info on the 'net

    Gray treefrogs catch insects and other invertebrates for food. They are quite acrobatic catching flying insects in mid air. They hang around street lamps or other lights at night. They are commonly seen on windows and sides of cabins or rural homes at night. They remain hidden in little crevices or other loose shelters during the day.

Page 3 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •