We have his IP addresses and now that we are dead sure, will will be catching him faster next time. We will not put up with his type of people here, and I am writing his parents letters. Ludwig, will you e-mail me the address you have? I will get his Alaskan address out of the ********** database. I am sure his parents will be so proud. Havin a son commit mail fraud and theft is surely one of the heights all parents strive to for their children.
[/QUOTE]
Ram, just a thought....back from my school days of mis-behaving....
How are you going to be sure that the letter you write will make it to the parrents, and not get intercepted and torn up by that little gremlin?
Since this is a federal offense (as copper pointed out), maybe having the COPS contact the parrents would be a little more effective? Not sure if this is practical...I've never had to report someone to the police.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
N=R* fs fp ne fl fi fc L
2 parents, 2 addresses, 2 different states. Even if a 'little gremlin' snatches one letter I doubt it can hop a plane and catch the second one
'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'
See You Space Cowboy
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
Hagerstown, Maryland
--
actagggcagtgatatcccattggtacatggcaaattagcctcatgat
| Quote | 2 parents, 2 addresses, 2 different states[/QUOTE]
NICE!
Man, I wish I could be there when the manure hits the fan! *What a show! *Who's selling tickets?.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
17 Nash Rd.
North Salem, NY 10560
YOU! Outta my gene pool!
Looks like it came back to bite him in the butt.
And though the Heavens and the Earth pass away.
Her actually, as it was recently pointed out to me, Nethaniel, is a she.
Any how, things are not so simple that we cna just stop new members from registering with free accounts... trust me, I am looking in to ways to make it harder for some people to sneak back in.
but you know, in the same vein, we have actually allowed a couple of people to think they have snuck back in to see if they will modify their behavior and play nice, and it has worked out for the better a couple times.
Demi Nethaniels case is different, thievery is a serious flaw in charachter, and is obviously a violation of the law, we can not, and will not ever let her be a part of this board again.
\"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey
are you sure he/she is a she? I thought he said he was a he in the chat room... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
what about a IP-Bann?
Darn it. If i cant say it there, I'll say it here. Ludwig, your money has been sent, and I would apreciate a modest apology for the nasty things you said about me once you recieve it. That goes for you too Ram! You take things too personally! I think it's aweful, all the judgements you made. Now I'm here to pass judgement on you all. It's rediculous how you just go and judge people without even communicating with them. It's sickening!
And another thing. I understand your all thinking that I'm no good, but thats no excuse. It really just isnt right. Im gone, and may we all finally be at peace.
Nepenthes Specialist
| Quote (JUDGEMENT DAY @ May 13 2003,02:06) | I think it's aweful, all the judgements you made. *Now I'm here to pass judgement on you all. *It's rediculous how you just go and judge people without even communicating with them. *It's sickening![/QUOTE]
But it's ok for you to commit mail fraud and steal people's money? Belive me the jugement about you is clear. I also belive it is appropriate to lock this to prevent a possible ugly situation from developing. Dont' come back either. [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img]
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|
|
|
