User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: Albino D.filiformis var. tracyii

  1. #1
    Metal King
    Join Date
    Jul 2004
    Location
    St.Catharines, Ontario,Canada
    Posts
    853
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a couple of what I have been told are super-rare pure albino D.filiformis var tracyii plants which have produced hordes of seeds.
    I have been toild they should be true to the parent but I just wanted to get a few more opinions on it before I make a trade and someone gets plain ol D.filiformis var tracyii plants next year and is mad at me

    And I am POSITIVE as to the totaly albinicity (I'm also positive that "albinicity" is a made-up word but hey, at least I know that) of tha plant and it's relative rarity (possibly moreso in Canada I guess) but I really want to know if I can make more with seeds since sending cuttings doesn't usually work too good

    Any thoughts??
    Da Growlist

    "You don't need a license to drive a sandwich"-Spongebob Squarepants

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Carl,

    If by albino we are refering to an anthocyanin-free plant then yes, the seed should breed true. Antho-free is recessive so all selfed seed should only contain the recessive allele.

    ANd on a tangent note. I am guessing that the only difference between this plant and a typical ssp. tracyi is that this one has white blooms. Is that correct?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Metal King
    Join Date
    Jul 2004
    Location
    St.Catharines, Ontario,Canada
    Posts
    853
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks for the reply Travis!!
    I suppose that the white flower is the onlyreal noticable difference, since the last "tpyical" D.filiformis var tracyii I had looked pretty much the same but with pink flowers. It seems to be a tad more robust as well, but considering I killed the last one, maybe the things I've learned since then could just be making it larger (PS it isn't an "oddball" but would you want some seeds??)
    Da Growlist

    "You don't need a license to drive a sandwich"-Spongebob Squarepants

  4. #4
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Just in case the plants from seeds don't breed true or don't germinate, I would strongly suggest that you take as many leaf cuttings as you can and propogate that way, as a backup plan. As they say on Long Island, "It may not help, but it vouldn't hoit".

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •