User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 24

Thread: Aside from D. paradoxa.......

  1. #9
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Actually, I am trying to do some semblence of your method, only I have to go cheap. I don't even know what a light diffuser is. I just have a Grolite at the moment. I'll take another look at the pinned topic. My frustration is getting a grate or slotted something to fit in the tank so that the pots can rest on top and receive the humidity.

    On a sidenote, dormancy = death for every Petiolaris plant I ever had. Oddly enough, though, in spite of the constant moving around in the past couple weeks, my lanata, linifloras, and 2 neps aren't reacting. The lanata actually has dew on 4 leaves!

  2. #10
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    No, that was tuberous sundews. Where did I see that topic?

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Jim,

    You can find light diffuser in the lighting section of Home Depot. It is a plastic grid about 45cm x 75cm and you can cut it to size using wire cutters or heavy duty scissors. Costs about $4 IIRC (been a while since I bought any). I am sure if you asked someone at HD they could direct you to it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Between our last posts I found something at the local dollar store that works. I bought 2 plastic containers that have one open end and 5 sides with 3/4" holes. I had to rotate one so that the two could fit together, which is good for adjusting the height, relative to the light and pot height.

    2cm... how mant inches is that? Don't I have multiply or divide by 2.54 or 3.936?

    So far the lanata seems happy enough to have dew.

  5. #13
    cmm889's Avatar
    Join Date
    Dec 2007
    Location
    Lawrence, Kansas
    Posts
    551
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    my 2nd cp ever was a lanata actually and I obviously totally unaware of the difference between sundews at the time, grew it just like every other normal drosera and it grew happily fully dewed for almost an entire year... I had it in a tray under a single cfl and it was happy as could be... until I had to rid it of my aphid infestation... it didnt appreciate the drowning to say the very least...

    complete digression I know, but the thread got me to thinking how lucky it lived even that long...

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by JustLikeAPill View Post
    As for myself? To the ARCHIVES archives archives archives.... I couldn't find it via the public search and going through each back issue on the member's site would take forever. I don't think you can search them anyway. And I don't actually know the difference between the public search and the member's area.... dun dun duuuuun.
    Alright, as promised I have found the CPN in question.

    You want the March 2001 volume. Page 21. Article written by Mike Wilder.

    What he describes in nearly identical to my set up with minor variation. I use more water and a slightly higher wattage heater than he describes.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Travis, where's the picture of your setup? I can't find it here or across the Pond. I have a mental image of yours, Peter's, and Chuck's setups, but nothing I can look at.

    actagggcagtgatatcccattggtacatggcaaat
    Hey... is that a reference to Adenosine, Cytosine, Guanine, and Thiamine? No Uracil?

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Jim,

    Here is the link to my old set up:

    http://www.terraforums.com/forums/sh...%2C+How+I+grow

    Only difference now is that I have the tanks set in their normal orientation as the silicon around the plexi sprung a leak and the water on the floor did not go over too well with my wife (not that I blame her for that reaction.)

    Hey... is that a reference to Adenosine, Cytosine, Guanine, and Thiamine? No Uracil?


    Yes it is a reference to DNA. No Uracil as that is for RNA but by asking you are moving in the right direction for translating it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •