User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: what's wrong with my Drosera kenneallyi

  1. #1
    Learning How To Multiply Indigo's Avatar
    Join Date
    Jan 2009
    Location
    MD, Zone 7~8
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    what's wrong with my Drosera kenneallyi

    Hello TF'er

    Wehn i got home from work and check my Drosera kenneallyi growing in outdoor is doign smething weird.



    Sorry about the bad photographic skill. as you can see that the Drosera kenneallyi starting to grow multi growth point from the rizhome, what should i do? its making the Drosera kenneallyi look weird. can i division it?

  2. #2
    ermahgerd petmantis's Avatar
    Join Date
    Nov 2008
    Posts
    1,124
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Divide it once the new points have roots and are independent of the mother plant.
    <Heli> How are you guys losing your hamatas?
    <Brokken> Heli: The hamburglar.

  3. #3
    Learning How To Multiply Indigo's Avatar
    Join Date
    Jan 2009
    Location
    MD, Zone 7~8
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ok =] Thank you.

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just a note, the process of rosette division in D. kenn can take upwards of a year so do not get over eager to split it. Personally I would just let it be. The rosette will divide and migrate away from one another
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Learning How To Multiply Indigo's Avatar
    Join Date
    Jan 2009
    Location
    MD, Zone 7~8
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Pyro View Post
    Just a note, the process of rosette division in D. kenn can take upwards of a year so do not get over eager to split it. Personally I would just let it be. The rosette will divide and migrate away from one another
    Ya i will try that. its just that the D.kenn doesn't look too pretty like that XD. look more like a mutation. how long does it take for it to to mirgrate away from now?

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Indigo View Post
    how long does it take for it to to mirgrate away from now?


    Quote Originally Posted by Pyro View Post
    the process of rosette division in D. kenn can take upwards of a year
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    Learning How To Multiply Indigo's Avatar
    Join Date
    Jan 2009
    Location
    MD, Zone 7~8
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    )

  8. #8
    Learning How To Multiply Indigo's Avatar
    Join Date
    Jan 2009
    Location
    MD, Zone 7~8
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Drosera kenneallyi is a tropical sundew right?



    edit what I want to ask is does Drosera kenneallyi need dormancy?

Page 1 of 2 12 LastLast

Similar Threads

  1. Woolly Cross: Lanata x Kenneallyi
    By DrWurm in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 07-13-2009, 03:26 PM
  2. What's wrong with my Drosera Filiformis?
    By Wolfn in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 3
    Last Post: 03-30-2009, 09:05 PM
  3. D. lanata and D. kenneallyi flowers coming
    By DrWurm in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 1
    Last Post: 09-13-2008, 03:51 PM
  4. What did I do wrong?
    By villa99 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 7
    Last Post: 03-27-2007, 09:08 PM
  5. Drosera kenneallyi
    By pingman in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 2
    Last Post: 09-10-2006, 04:26 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •