User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: Ickle sundew

  1. #1

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    *girlish squeal*
    I woke up this morning to fined my thrid and final spiecies of sundew seeds have sprouted! I can't beleave it, overnight they just shot out of the ground and are just as tall (althogh oviously smaller girthed) as my other seedlings. I'm so happy to know that I got some of each plant! ...I am sorry, I can not spell their names... maybe I should tape a list of my plants to the wall so I can do so later....
    *wanders off to find seed lables
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Moving to the 'Dew forum
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Neps, Neps, Neps.........
    Join Date
    Nov 2002
    Location
    San Diego, CA
    Posts
    436
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Darcie, congratulations on your new babies. I'm still looking for sprots in my seed trays, how long did you have to wait to see germination?

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Yay Darcie! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Baby D. Spatulata's kinda look like the stars at night, don't they?

    Hi Ludwig,
    It all depends on what kind of seed you sow. I can only tell you from experience that Spatulata and Capensis take 4 to 5 weeks, and Aliciae takes 3 to 4 weeks. I don't know if this is typical, but that's what happened to me.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I planted my seeds mid october, the Capes sprouted about 2 weeks ago, the angelica(sp?) about 4 weeks ago. And I just found another Cape today (very tiney right next to the larger one. Yes, my spats do look like a little twinkle [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] I'm glad thats what you thought they where because I am having trouble telling which seedling is which, lol
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

Similar Threads

  1. sundew id
    By cp-connection in forum Identify That Plant!
    Replies: 10
    Last Post: 01-14-2010, 05:16 PM
  2. Just got my first sundew
    By divaskid in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 7
    Last Post: 06-22-2004, 03:21 AM
  3. Sundew
    By now_what_do_i_need in forum Carnivorous Plant Trading Post
    Replies: 9
    Last Post: 05-24-2004, 07:28 PM
  4. Ickle sundew
    By Darcie in forum General Discussions
    Replies: 1
    Last Post: 12-10-2002, 02:32 PM
  5. What sundew is this?
    By sarracenia in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 5
    Last Post: 06-12-2002, 05:17 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •