User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 17

Thread: Help help help...

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    It's all turning brown and wilting! There's plenty of humidity, not too much sun (I don't think....4-5 hours). It flowered just fine, and now it's bone dry, despite the humidity...What am I doing wrong? Do they need it really warm? The weather's been pretty changeable.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Could be the sun, this species tends to like it on the dark side. Flowering could have sapped a little of its strength too. What are your full conditions? It'll help us to pin down what is happening
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Pyro,
    My full conditions:

    Sun: 4-5 hours

    Humidity: Terrarium, Very humid (don't have a number, but I feel safe saying over 80%)

    Water: Tray method

    Temp: Fluxuates, nights have gotten pretty chilly, in the 50's every now and then. Although sometimes it doesn't go below 80. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

    Soil: still in the pot I bought it in (LPOH)

    Does this help?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How long ago did you buy it? It might be a soil issue. These guys tend to do best in pure sphag so you might want to consider a repot. The humidity sounds good. Light might be too bright but I mentioned that. The temp worries me. These guys come from a tropical area and generally do best if kept above 60. I don't think a breif drop to 50 would hurt them but repeated drops could make them slide.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Thanks Pyro,
    I will re-pot and bring inside. I have a place that gets more light, but it's not direct sun, so it shouldn't burn.

    You Rock! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Try for a spot that gets no direct light but still has good light.

    Hope it recovers fast for you
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The plants are pretty hardE, mine came back after it looked the grim reapper was about to grab it. Sometimes if you change the enivorment a little and bring it back to the old enviroment it will recover.

    travis
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  8. #8

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Adelae often dies back after flowering. Just continue with the basic care you are giving the plant. Repotting is a good idea, there is always a chance the substrate has been contaminated with mineral salts, esp. if distilled or rain water aren't being used. The plant should regrow offsets from the roots. Mine has pretty much died back after flowering all spring: the process exhausts the plant, but already new offsets are appearing, so it will only be a matter of time. I have found the plants like cool conditions for me, so the cool nights are actually a plus. I never expose my plants to sunlight, but a friend in Brazil grows his in full sun in their hot, hot summer. The plants grown in this way are smaller, darker and hardier. The plant responds to many different conditions. It really hates drying out, even briefly, so keep it very wet. Humidity seems a secondary issue to this: I have plants under 50% humidity that are doing just fine. I think the most critical factors for this species are wet conditions, not too hot, and not too bright all at once. Good luck.
    "Grow More, Share More"

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •