User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: What kinds move

  1. #1
    leftyman
    Guest
    what kind of sunduws move that you can buy at pet fly trap.com?

  2. #2

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    WLCOME TO THE FORUMS!
    I hope you get all of your questions answered and have a good time.

    all of the sundews at ********** move. what kind of move do you want? just the tentecles, or the whole leaf?

  3. #3

    Join Date
    Oct 2002
    Posts
    115
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am not sure but I think all sundews move . If your just getting started with sundews go for the cape sundews or the ones this site sells that are easy to grow.

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Most Drosera species move, but the motion is not immediately apparent in most of them. Capensis, burmanii, regia are some that are more rapid than others.
    "Grow More, Share More"

  5. #5
    Moderator Colieo's Avatar
    Join Date
    Jul 2002
    Location
    Indianapolis, Indiana, USA
    Posts
    724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My spathulata, and burmanii are my two biggest movers. The spathulata folds its entire leaf over the prey(although this can take some time), and you can watch burmanii move if you stimulate the outer retentive tenticle enough. It is very cool to watch!

    Cole
    Duele no tenerte cerca, duele no escuchar tu voz. Duele respirar tu ausencia, pero, duele más decirte adiós.

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My spatulata catches lots of gnats, and the leaves look like clenched fists while eating....kinda cool [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    My Capensisies (plural spelling?) are a little more relaxed, they just bend a little usually.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a capensis 'alba that has fully wrapped itself in a knot around a moth. Kinda funny looking.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Guest
    With D. capensis, the larger the meal, the more it folds around its prey.

Page 1 of 2 12 LastLast

Similar Threads

  1. Big Move
    By Ozzy in forum General Discussions
    Replies: 19
    Last Post: 12-24-2008, 08:16 AM
  2. My mind has just been blown with the selection of different kinds of lights.
    By JB_OrchidGuy in forum Greenhouses, Terrariums and Bog Gardens
    Replies: 4
    Last Post: 02-15-2008, 08:26 AM
  3. When to move?
    By Goofzilla in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 3
    Last Post: 05-23-2006, 07:00 PM
  4. To move or not to move
    By kahnli in forum General Discussions
    Replies: 9
    Last Post: 04-29-2005, 10:07 AM
  5. at pet fly trap they sell two diferent kinds of sundews what
    By Joel in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 3
    Last Post: 03-17-2002, 08:42 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •