User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 5 FirstFirst 12345 LastLast
Results 25 to 32 of 36

Thread: Lowrie order

  1. #25

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Have any of you contacted the Australian Government with your concerns? Have any of you asked him himself? This could be some serious libel if you are wrong. Here in America many people say that Germany is exporting biowarfare technology to Saddam. I personally thing they are misinformed, because it seems like just a bunch of speculation.

    Really, the man is not here to defend himself! If you wonder about his ethics, don't you think you should have some proof before you implicate him on an international forum? What if they are wild collected and he got a permit? Don't you think Australia is sophisticated enough to run it's own affairs?

    When I was in South Africa we were inundated with well meaning but uninformed accusations about how we treated our flora and fauna, and it especially irked us that some of the people leturing us had not much of a record environmentally.

  2. #26

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    Can I ask what the difference between "wild collected" and "field collected" are? To me they both seem like the same thing, only "field collected" sounding a little nicer than "wild collected". If they are the same then wouldn't the seeds listed as "field collected" be the only ones that were collected from the wild? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    Lithops care info: If you take care of it, it will die.

  3. #27
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Folks,
    I think Tim is right. I don't think he could run a business with the proper permits, etc. I can see how you would be concerned if he was just some shmoe you met in a chat room, but Mr. Lowrie has an established thing going on here. He has a catalog, for cryin' out loud. While it's possible he's opperating under the radar, it's not likely.
    Also, if Mr. Lowrie is anything like us here at PFT, he loves his plants, and would never do anything to harm them.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #28
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ditto what Tim and Schloaty said,

    It would behove people to check things out before making blanket accusations, Australia's import and export rules are orders of magnitude beyond the US and as such it would make it really difficult to get wild collected material out
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #29

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This is what Dr. Barry Meyers-Rice had to say today in reply to my inquiry on this subject, which echos my own sentiments.

    Hey William,

    What I'm about to say can go on the record, no problem. You can post it if you want.

    Regarding Allen Lowrie and field collecting in general.
    This is not an area with black and white, I think. First off, let me reiterate that I am well known, and justifiably so, as a person who is something of an idealist regarding conservation issues. Anyone who has read my FAQ has seen my rants and tirades about the importance of high
    conservation morals. That being said...

    Field collection is not universally bad. There are many cases in which the reproductive production of seeds (for example) far outweighs the possible number of seedlings that can be supported at a site. For example, at a Darlingtonia study site of mine, each year the seed production is vast, however there is extremely little seedling activity---nearly all the
    reproduction is due to vegetative propagation. (On the other hand, if a wildfire sweeps through, and opens up new habitat, reproduction via might become more dominant.) So whether or not you should feel righteous or condemnable when collecting seed depends upon the situation. And keep
    the following corollary in your back pocket---if you are ever unsure, DON'T COLLECT!

    Anyway, I certainly would agree that collecting Drosera tubers carries more impact than collecting seed. And I would imagine that for each tuber collected, a number are destroyed by the sharp edges of a trowel. However,
    I have never visited Western Australia, and do not know what the population dynamics are like of the plants in this area. For example, are there many tubers produced each year by plants living in disturbance zones (such as along rivers) where a naturally high mortality of tubers is
    expected anyway? In this case, field collection might be more easily justified. Is the population small and restricted, with little seed reproduction, and does digging in the soil disturb the cryptogamic crust and soil structure? Then I would certainly advise against field collection.

    I simply have not visited the areas, have not botanized with Allen Lowrie, and don't know where the situation lies in the continuum between justifiable and unjustifiable field collection.

    I have heard people say both good and bad things about Lowrie. But I've read both good and bad about myself, too! Lowrie is something of a character, and has rubbed some people the right way, some people the wrong way. (Again, the same can be said about myself.)

    I will say this, however. Lowrie has done a lot for our understanding and appreciation of the carnivores of Australia. On balance, even if he were crossing the line re: field collection, he's a net asset to the flora of Australia.

    If you're worried about this stuff with Lowrie, write him a letter, express your concerns, and mention the species you are interested in. Maybe he'll tell you information that can help you in your assessment on whether to order.

    Later!

    Barry

    ------------------------
    Barry A. Rice, Ph.D.
    Carnivorous Plant Newsletter
    Conservation Coeditor
    barry@carnivorousplants.org
    http://www.carnivorousplants
    "Grow More, Share More"

  6. #30

    Join Date
    Dec 2002
    Location
    Munich/ Germany
    Posts
    348
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,

    the informations I got are basically the same Julian (carnivore) posted already. These informations I do trust knowing the people mentioned personally. It is of course up to everyone to make his personal mind up on this topic. I would be very glad to change my mind as soon as ther are supporting facts of course.

    I already did know the thoughts of Barry concerning field collecting of seeds and plants from his posts. I won't go into this in detail, but I greatly disagree with Barry on this topic. For me the arguments given do open the door to field collecting way too much.

    Joachim

  7. #31

    Join Date
    Sep 2001
    Location
    California
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    I don't think he could run a business with the proper permits, etc.[/QUOTE]

    Sure you could. In the U.S., it's easy to get a permit to open a nursery and collect plants or seeds from public property, esp. when they are not listed under some environmental protection law.

    Wild collecting tubers are definitely more detrimental, than collecting seeds. Like Barry Meyer-Rice pointed out, many times germination is low, but what if the germination is high?

    The argument fails w/ Lowrie being loving to plants so wild collecting is okay, simply since he trades materials w/ others as the others might not be so "loving". Love can also be blind.

    Anyone could come up w/ a catalog. In the 70's and 80's, you could get a VFT from some gag company listed next to the whoopee cushion. Additionally, Barry M-R's FAQ also mentions a nursery that wild collects, and the owners published 2 books.

    Quote
    If they are the same then wouldn't the seeds listed as "field collected" be the only ones that were collected from the wild?[/QUOTE]

    Both "wild collected" and "field collected" are the same in my book. When there's no "field collected" label associated w/ a species, it could be from non-field collected plant or it also could be from a lack of information from the collector.

    Sorry if it sounds like I'm attacking anyone personally, but I'm just trying to point out the possiblities. I personally wouldn't order anything until I gathered more information from Mr. Lowrie regarding the plant material.

  8. #32

    Join Date
    Sep 2001
    Location
    California
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    When I was in South Africa we were inundated with well meaning but uninformed accusations about how we treated our flora and fauna, and it especially irked us that some of the people leturing us had not much of a record environmentally.[/QUOTE]

    Tim,

    It's easy to see others' flaws, and not see your own. At least they were trying to protect the wildlife.

    Going off-topic, what do you think of the accusations regarding Sierra Leone's diamond industry? Are they misinformed? You could PM me instead of posting a direct reply here.

    Page 4 of 5 FirstFirst 12345 LastLast

    Similar Threads

    1. Lowrie Import...from Jeff
      By obregon562 in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 7
      Last Post: 05-01-2009, 01:29 PM
    2. Question allen lowrie
      By KingShaman in forum General Discussions
      Replies: 8
      Last Post: 03-16-2005, 12:14 AM
    3. Lowrie order
      By The Griffin in forum General Discussions
      Replies: 5
      Last Post: 03-11-2003, 12:28 PM
    4. Anbody want to pool on a lowrie order?
      By The Griffin in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 9
      Last Post: 02-12-2003, 04:00 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •