User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 5 12345 LastLast
Results 1 to 8 of 36

Thread: Lowrie order

  1. #1

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Everyone,

    A couple of people have contacted me with some stuff they want to order, but I need to know if you want anything ordered with my order by Thursday Morning at the latest, so I can fax the man and let him know. Obviously I am talking to the people who requested catalogs.

    Thanks,

    Joe

  2. #2

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Joe,
    I haven't seen the catalog yet, but please put me in for 2 units of U. menziesii tubers and let me know what to send by way of payment to you.
    "Grow More, Share More"

  3. #3

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Tamlin

    Just to save you a bit of time, Allen has tubers of the following D. menziesii forms listed in his current catologue:

    D. menziesii subsp. menziesii 'red plants' $7-00 AUS
    D. menziesii subsp. basifolia $8-00 AUS
    D. menziesii subsp. penicillaris $8-00 Aus

    There are about 2 $AUS to one $US, very roughly, better check that.

    Cheers
    Vic
    They say that money talks, but all it ever says to me is goodbye.

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Vic,

    Tamlin actually wants Utricularia menziesii [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] But it is easy to understand the confusion.

    Tamlin,

    I believe Joe said that these are $10 AUS a piece so you are looking at about $10 US.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Tamlin,

    Yours was mailed, but it was Saturday. I would think it would be in today's mail.
    There are two Utric menziesii tuber types.
    red flower, yellow palate and red spur

    red flower, orange OR red palate, and yellow OR red spur

    $10 ea AU, so for two and me shipping them to you should be $14.50 in US, or so.

    Regards,

    Joe

    BTW, Vic was right about DROSERA menziesii forms, lol.

  6. #6

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry, my speed readings not all it used to be! I thought he already had the Drosera though. Enjoy your order, I just received my first (but not last) A. Lowrie order on Saturday, better than Christmas [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Cheers

    Vic
    They say that money talks, but all it ever says to me is goodbye.

  7. #7
    Neps, Neps, Neps.........
    Join Date
    Nov 2002
    Location
    San Diego, CA
    Posts
    436
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello, would like Drosophyllum, let me know it's availability, I can paypal you. Thank you.

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Angry

    Shot you a PM.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 5 12345 LastLast

Similar Threads

  1. Lowrie Import...from Jeff
    By obregon562 in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 7
    Last Post: 05-01-2009, 01:29 PM
  2. Question allen lowrie
    By KingShaman in forum General Discussions
    Replies: 8
    Last Post: 03-16-2005, 12:14 AM
  3. Lowrie order
    By The Griffin in forum General Discussions
    Replies: 5
    Last Post: 03-11-2003, 12:28 PM
  4. Anbody want to pool on a lowrie order?
    By The Griffin in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 9
    Last Post: 02-12-2003, 04:00 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •