User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 4 1234 LastLast
Results 1 to 8 of 25

Thread: Gotta question

  1. #1
    Warped54321
    Guest

    Unhappy

    I would like to know if somebody could please tell me of about 3 or 4 carnivorous plants that dosen't go through dormacy (if there are any that is)
    -Thanx, Warped [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey warped,
    There are lots of cps that don't go dormant...since this is the 'dew forum, you want to look for tropical drosera. I going to take wild guess that you're new to this [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] and sugest you try D. capensis or D. spatulata as one of your first 'dews. These guys don't go dormant, they're really easy to care for (great way to get your feet wet), and they reproduce abundantly giving you something to trade to expand your collection (they were a huge driving force behind my early expansion).
    There's tons more 'dew that don't go dormant, but I'll let you find those yourself (think EASTER EGG HUNT!! WOO HOO!&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] ....also look into nepethes when you get some experience under your belt (or not...there are some really easy species there, too).

    Good luck! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    Warped54321
    Guest

    Post

    Oh yippie...easter egg hunt...

    I use to have a spatulata...it fell of the porch( My sisters fault [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] )

    Do nepenthes go dormant?

  4. #4
    Warped54321
    Guest

    Unhappy

    Umm...this site dosen't sell some of the types of carnivorous plants I've heard about...what other good places (if any) would sell carnivorous plants.

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Warped,

    Neps do not go dormant so they are also a good bet to try. Any tropical Drosera would work well too.

    I do believe that PFT sells D. capensis, spatulata and adelae all of which are great beginner plants. They also sell numerous Neps that are good starters. If you don't see it on the website, maybe try calling the 800 number [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Warped54321
    Guest

    Lightbulb

    I couldn't find the capensis. [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

  7. #7

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    It's not on the site, but if you e-mail or call, they'll have some for you!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]
    I am back..

  8. #8
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quick questie! Do adelae go dormant? This matter has been itching my brain ever since I got my adelaes...
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

Page 1 of 4 1234 LastLast

Similar Threads

  1. I gotta do it again
    By NeciFiX in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 33
    Last Post: 11-10-2009, 08:13 AM
  2. ive gotta better plan..............
    By rattler in forum General Discussions
    Replies: 17
    Last Post: 02-12-2008, 04:30 PM
  3. Gotta question
    By Warped54321 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 2
    Last Post: 07-22-2003, 07:41 AM
  4. Gotta question
    By BigCarnivourKid in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 8
    Last Post: 03-09-2003, 03:01 PM
  5. I gotta question
    By Warped54321 in forum Pitcher Plants: (Sarracenia, Heliamphora, Darlingtonia, Cephalotus)
    Replies: 3
    Last Post: 01-20-2003, 12:41 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •