User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: Does anybody have that one quote?

  1. #1

    Join Date
    Jan 2003
    Location
    Gilbert, AZ
    Posts
    86
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Just wondering if somebody had that entire quote from that english scolar about sundews. i know the svage garden mentions it, but i was just wondering. The one that ends like this "Dew of the sonne, or sonne dew'. Thanks in advance!!!
    And though the Heavens and the Earth pass away.

  2. #2

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Gadzooks,

    In faithe, a bonnie request. Knocke thyself oute.



    http://home.pi.be/nepenthes/Youth%20woort.html
    "Grow More, Share More"

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think it is actually in Slack's first book. I have it at home and can get it to you this evening or something [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here we go. From Slack's first book Carnivorous Plants page 119:

    Henery Lyte, the botanist squire of Lytes Cary Manor in Somerset, may have been the originator of its English name, for he has the following to say in his New Herbal of 1578

    "This herbe is of a very strange nature and marvelous: for although that the sonne do shine hoate, and a long time thereon, yet you shall finde it alwayes full of little droppes of water: and the hoater the sonne shineth upon this herbe, so muche the moystier it is, and the more bedewed, and for that cause it was calles Ros Solis in Latine, which is to say in Englishe, the Dewe of the Sonne, or Sonnedewe"
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Man...And we complain about the english language TODAY...Holy cow, it was HORRID back then! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •