User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Drosera multifida "Extrema"

  1. #1
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    i have just recieved Drosera multifida "Extrema" seeds from Pyro (Thanks man!! ) and i have attempted to search the carnivorous plant database for Drosera multifida "Extrema" and cannot seam to find information on dormancy. stratification... etc. etc. can anyone please take me threw the search process so i can help myself in the future?
    THANKS
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  2. #2

    Join Date
    Aug 2002
    Posts
    141
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    grow like other binata this does not require a dormancy but can go into one if it drops below 40F. It needs real bright light and humid condtions my binata that i have,grow real nice in L/f sphagnum,soaked. it would probely be a good idea to keep the seeds in the fridge for a couple of weeks, becouse iam pretty sure it had pretty cold winters in Queensland. They can come back from brief hard freezes so they are pretty cold tolerant. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] oh and the best way that i have found to research is to type the name of the plant right into to the search of like yahoo, you come up with more info than you can handle for most plants.


    cheers,


    Joel [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  3. #3

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You should try google.com thats where I found **********! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  4. #4

    Join Date
    Aug 2001
    Location
    San Francisco, CA
    Posts
    988
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    that is really nice and large forked dew. Looks especially nice in a ahanging basket if humid enough. Sow seeds over a mix of peat/sand.
    Taproot, Anti-Flag, The Casualties, Alkaline Trio, Eleventeen, Deadsy, AFI...what's not to love?

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Andrew,

    I am PMing you all the information you need [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    p.s. Joel, Queensland is compltely tropical, no winters at all [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Aug 2002
    Posts
    141
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well my bad, i guess i should have checked into the that i always have figured it for being a bit cooler.



    cheers,

    Joel

  7. #7

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The reason this failed to come up on the CP Data Base is your spelling. There is no Drosera multifada, only Drosera binata var. multifada 'Extrema', and I do believe the Extrema at the end is legitimate, as this is a registered cultivar. Try the search using this name and all should be well.
    "Grow More, Share More"

  8. #8
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Excerpt from the Carnivorous Plant Database:

    N: ~[Drosera binata {Labill.} var.multifida {Mazrimas} f.extrema {Hort. ex Gilbert}]nom.nud.
    P: Carniv.Pl.Newslett.13:74 (1984)
    S: =[Drosera binata {Labill.}]

    Just click on the link below and you will see a long list of results including the one in question:

    CP Database - search results for Drosera binata
    Joseph Clemens
    Tucson, Arizona, U S A

Page 1 of 2 12 LastLast

Similar Threads

  1. Drosera multifida 'Extrema' pic.
    By Lil Stinkpot in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 16
    Last Post: 11-05-2009, 06:02 PM
  2. Multifida "Extrema" Mutation and Madagascariensis
    By DrWurm in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 3
    Last Post: 07-17-2009, 08:50 AM
  3. multifida "extrema" for trade
    By cp-connection in forum Carnivorous Plant Trading Post
    Replies: 4
    Last Post: 04-22-2009, 06:50 PM
  4. Drosera binata, D. capensis "Red" & "White" seeds for SASE
    By Not a Number in forum Carnivorous Plant Trading Post
    Replies: 27
    Last Post: 08-22-2008, 10:55 PM
  5. Drosera multifida 'extrema'
    By PoWeRPSUHort in forum Carnivorous Plant Trading Post
    Replies: 1
    Last Post: 10-25-2005, 05:36 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •