User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Inducing gemmae production

  1. #1

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hello all! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    Well, I'd like some good gemmae from my D. 'Lake badgerup', so, I read about the reduction in length of daylight, but what's a legitimate reduction sundew wise? So far, I reduced it about 25 minutes, now should I let it just get acclimated? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] thanks! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    I am back..

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Gradual reduction to about 8-10 hours of light followed by uninterupted dark is what I have heard.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Wellllll, the only teeny, tiny, teeeeeeny thing is: It's in a terrarium with neps! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] So, should I take them out? [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] P.S. Thanks! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    I am back..

  4. #4

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mine usually produce gemmae in the fall: october or novemberish. So what Pyro recommends sounds about right.

  5. #5

    Join Date
    Jan 2002
    Location
    Southern CA, US
    Posts
    1,058
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You do not have to take out the nepenthes. The pygmy droserae that I grow outdoors produce gemmae during late Nov.-Jan and sometimes into Feb.

  6. #6

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    But if he isn't growing them outdoors then he will need to vary the photoperiod in order to induce gemmae production. What he is asking is: will the reduced photoperiod neccessary to induce gemmae production have any effect on the neps that would neccessitate their removal from the terrarium.

    I don't know the answer. You should ask in the nep group.

  7. #7

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    Actually I meant should I take out the pygmies (3)
    I am back..

Similar Threads

  1. Inducing Nepenthes budding
    By F R e N c H 3 z in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 5
    Last Post: 03-02-2009, 01:26 PM
  2. Inducing Nepenthes to flower
    By Spectabilis73 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 10
    Last Post: 03-01-2009, 02:19 PM
  3. Gemmae Production.. or the lack thereof
    By jimscott in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 0
    Last Post: 10-31-2008, 09:58 AM
  4. Pitcher Production
    By glider14 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 10
    Last Post: 12-16-2005, 09:54 PM
  5. Pft vft var. and the mutation inducing chemical
    By timbudtwo in forum General Discussions
    Replies: 5
    Last Post: 05-21-2003, 07:51 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •