User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Drosera madagascariensis

  1. #1

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Since the post on South African species is getting some good results I thought I would open some threads to keep things sorted.

    Please add your comments, thoughts and photos to this thread. Thanks!
    "Grow More, Share More"

  2. #2
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    The plants which you sent came labeled as sp. Botswana, not sp. Rhodesia. The plants were very tall, on an ascending stem, with many brown leaves along its length. If you sent sp. Rhodesia, I never got them. The plants you sent went dormant, but came back. No flowers yet, and I anticipate another dormancy soon.[/QUOTE]

    To continue the discussion...

    Tamlin,

    yes, you are right, I meant that I had sent you sp. botswana, my mistake.

    do you see any differences whatsoever between sp. botswana and madagascariensis major? If so, what are they?

    I am especially interested in this species. Matt has a few pics on his site:


    drosera madagascariensis 'rhodesia'
    drosera madagascariensis var. major
    drosera sp. 'Rhodesia'

    is there a difference between sp. rhodesia and madagascariensis rhodesia? The leaf looks similar, though not exactly the same. the sp. 'rhodesia' photo doesn't show a side view, and the plant also seems to be rather young. What is your opinion on this subject?

    noah

  3. #3

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Duplicate deleted



    "Grow More, Share More"

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Noah,

    Thank you for the reply and referral to Matt's webpage. The sp. Botswana you sent are doing well.

    To reply to your questions: I have had very little exposure to madagascariensis var. major. The overall form of the plants in Matt's collection so named appear to resemble "sp. Botswana" at least superficially. It seems the lamina appears slightly larger, and I believe this form deserves some attention. I am very interested in it as well, and would love to hear of it's origins if they are known, and how it was introduced into cultivation. I believe the seed will be interesting in regard to measurement.

    Of the other photos on Matt's page, here are my thoughts.

    "Sp. Rhodesia" looks very much like what I cultivate as nidiformis. I doubt that this plant is related to madagascariensis, although we have seen the involvement of other taxa all through the South African range, so this may be entirely possible. The two are distinct taxa, and the length of the seed would be a good determinator of this: nidiformis having short ovoid seeds vs. the longer seeds of madagascariensis. As an aside I also think plants circulated as "sp.Magaliesberg" are likewise this species.

    Madagascariensis "sp. Rhodesia" looks identical to "sp. Botswana" at least to the casual eye. The photos are a blurry, and further assessment of stipular and laminar hair is not possible. In my conversation with Vitor Olivera de Miranda who is working on claudistics of Droseracae in Brazil
    (two spacers from ribosomal DNA) he demonstrated that this
    species is very closed to D. madagascariensis. Its morphological traits lead us to the same conclusion as well; Unfortunately his speciens of D. sp "Botswana" did not produce flowers, so he just analyzed the other
    morphological characters of the plant. He is convinced that it´s D. madagascariensis. Probably any additional appelation is incorrect and not needed, as regards either "Botswana" or "Rhodesia".
    "Grow More, Share More"

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a D. sp. Botswana which I think is a varient of madagascariensis. Only had it a month but it seems real easy, just have it in peat:sand outside on my patio in full sun most of the day. Grows fast.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    noah's Avatar
    Join Date
    Aug 2001
    Location
    Senegal
    Posts
    538
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,

    Well, when you asked about origin I remembered I had read something somewhere, but I couldn't remember where. I searched the internet, checked my books, and then started poring over my cpn's. Sure enough, in Volume 28, #2 (June 99), Peter D'amato states:

    “Some folks on the carnivorous plant listserver chat line inquired about a plant I have circulated as Drosera “Botswana.” Although I am not a taxonomist, it appears this plant is Drosera madagascariensis, native to Madagascar and Africa.

    This plant was originally given to me by an actor who, at the time, did stunt work and played roles on the popular and controversial television show called “Power Rangers.” I have not seen him in a few years, but if my memory serves me correctly, he said he found the plant growing in a water ditch close to the Botswana airport.

    I have become very fond of theis plant, and many of my visitors have been pleased with it as well. This strain of Drosera madagascariensis forms a cluster of circular leaf blades with narrow petioles about one or two inches long, reminiscent of D. intermedia. Like that species, it forms long trailing stems, but up to 30 cm (12 inches) long. It makes new shoots from the base of the stem, so in time the plant produces a clump of stems of varying lengths, each cloaked with dead leaves and topped with an attractive rosette of new lamina. The leaves are pale in the subdued light, but in strong light they become a lovely crimson”

    That answers some questions. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] Basically d. sp. "Botswana" was never thought to be a seperate species. Do you see enough substantial difference from var. major for sp. "Botswana" to qualify of a supbspecies? (You mentioned the larger lamina...)

    On the subject of the 'rhodesias', Do you think Matt's plants are id'd incorrectly or can we then conclude that sp. rhodesia and madagascariensis 'Rhodesia' are not the same thing?

    noah

  7. #7

    Join Date
    May 2002
    Location
    Sweden
    Posts
    173
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,

    Some years ago I acquired some seed from A. Lowrie labeled D. madagascariensis ”short stem, large green leaves” near Pretoria and D. madagascariensis var. major near Pretoria.

    I got one ‘short stem’ and 4-5 var. major to germinate. The ‘short stem’ has so far been very vigorous while the var. major has been slow and stayed small.

    Since I had read about Fernandos travels in the area I inquired him last year about these plants and here’s what he replied:

    “Both Robert Gibson and I collected plants there at about the same time. And he said he went to the same locations I'd found previously since he was with the person who was with me when we found them. So I guess I can say that either way, you have the plant I'm thinking of. It is not regular madagascariensis as we're used to seeing in cultivation. It is nearly stemless and has large green leaves with long petioles and large tear-drop shaped lamina. The common form has long stems (usually reddish) with short petioles and small rounded lamina. They were growing in marshy natural springs among grasses at all sites. Very wet, but the water flowing constantly around them. I think this is what has been referred to previously as var.major, so I put this tag along to identify it at least as different from the regular ones we see in CP collections.”

    Although Fernando labeled the ones he collected var. major his description fits the ‘short stem’ as well, so I’ve been thinking that maybe Gibson labeled the ones he collected ‘short stem large green leaves’. My var. major haven’t grown well, but they still look more like normal madagascariensis, so I’m not really sure yet of what to make of it.

    Here’s a photo of the ‘short stem’ form, which is approx. 7 cm in diameter:




    Regards,

    Christer

  8. Similar Threads

    1. Drosera madagascariensis
      By mcantrell in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 11
      Last Post: 06-13-2009, 05:18 PM
    2. Drosera madagascariensis
      By cphog in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 14
      Last Post: 03-04-2006, 04:08 AM
    3. Drosera madagascariensis
      By Drosera36 in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 12
      Last Post: 12-13-2005, 10:38 AM
    4. Drosera madagascariensis
      By eBeyonder in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 9
      Last Post: 08-03-2005, 01:29 PM
    5. Drosera madagascariensis
      By NickHubbell in forum Sundews (Drosera), Byblis, Drosophyllum
      Replies: 1
      Last Post: 12-01-2003, 07:10 PM

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •