User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Mwhahahahahahahahahaha!

  1. #1
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    A couple days ago, right around twilight, I was out grooming the cps when I feel a prick on my leg. I look down and there's a dang mosquito!!! It was one of those black ones with the white stripes... wierd looking. Anyhowees, I plucked it off my skin, yes, with my fingers, and somehow that stunned it... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] ... so after I plucked it off my skin, I carried it over to guess who! The sundew! I put it on the biggest leaf and it got all stuck and I'm like, ''Now you see what happens when you bite me?'' LOL! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] The next day, I come out to tend the cps and I see that the sundew is happily(and hungrily)enjoying the troublesome mosquito, with it's bristles wrapped all around it! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    BTW, it is still feasting on it [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Revenge! I GOT MY REVENGE!!!
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Black mosquito with white stipes would be an Aedes porbably A. albopictus A pleasant mosquito that is the vector for such fun arboviruses as Dengue and recently believed to be a possible carrier for WNV
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh great... now I gave my little adelae WNV!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  4. #4
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FTG I am SO identifying with you on the mosquitoes. We recently had a TON of rain after about 2 months of nothing, so naturally, the skeeters decide it is time to breed.

    2 nights ago I went out to work on my plants on the deck, and didn't get 5 steps out the door before a cloud assaulted me. I ran back inside and swatted what came with me dead, but at the end of the day I had about 30 or 40 bites (felt like 80 to a hundred) all over me, legs, arms, chest, neck, back, one on my right cheek, forehead...

    Now, I am ok with the occasional bite... but this.. this was pure #### for 2 nights I have had to rub caladryl all over the bites, not because each bite is all that bad, but the cumulative effect of all of them keeps me up and drives me crazy!

    Well, last night I went out and didn't get attacked, sprayed the passiflora down with ortho, and checked out my forked dews... oh yes... they exacted a hearty revenge... I stopped counting at 20... and that was on one plant... there must have been a swarm of them out there that night...

    now, I seriously wish I had one of those skeeter machiens that attracts them with natural gas, and then traps and kills them... they are so effective you empty their traps out every day, cups and cups worth of mosquitoes... I wonder if I could sell them online as sundew food. (dead of course).... hmmm...
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  5. #5
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Good idea!!!
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  6. #6

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FlytrapGurl,

    Hmm, don't you think it's odd that the mozzie fed on you and the cp fed on it? So...now that your dew has tasted your blood, aren't you afraid it will try and wrap its tentacles around your pinkie finger at night? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    A flytrap ate my homework!
    -Michelle

  7. #7
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmmmm... good thing is, the sundew is OUTSIDE, and I'm INSIDE [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  8. #8
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    To paraphrase copper: "You are now one with your plant." [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •