User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Forked sundew?

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hi Guys and Gals,
    Wondering if anyone can help me out here. I have a pot of D. Spatulata that I got over the internet. Nice, healthy plants making lots of babies [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] .
    Questiong is: Two seedlings don't look like the other ones. They almost look like forked sundews of some sort... I think they are the result of seeds that fell in the pots before shipping, but I don't know how long they can take before the germinate. Does anyone know how long forked sundew seeds can just sit there?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just moving this to the dew forum [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Aug 2001
    Location
    San Francisco, CA
    Posts
    988
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    you should try to remove the seedlings carefully if the spathulata's are taking over. You can easily take them out by using a pair of twisers and taking out the seedling (s) with thier dirt ball around roots. replant in a mix of peat and sand and keep in similar growing conditions as spathulata for now. keep us updated. If you are willing to trade one, please let me know! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    Taproot, Anti-Flag, The Casualties, Alkaline Trio, Eleventeen, Deadsy, AFI...what's not to love?

  4. #4

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Drosera seedlings all look the same... don't they?

  5. #5

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yah basically

  6. #6

    Join Date
    Sep 2001
    Location
    California
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Not really. On the eye level you can notice that some seeds are more oval (egg-shaped), while others are longer and finer.

  7. #7

    Join Date
    Aug 2001
    Location
    San Francisco, CA
    Posts
    988
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmm...yup your rite, they look differeent at eye/dirt level lol.
    Taproot, Anti-Flag, The Casualties, Alkaline Trio, Eleventeen, Deadsy, AFI...what's not to love?

  8. #8

    Join Date
    Jul 2002
    Posts
    26
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    how do sundews reproduce, polonate or some thing else [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

Page 1 of 2 12 LastLast

Similar Threads

  1. Starter set forked sundew wmgorum $25
    By flytraplady5 in forum 2008 NASC Benefit Auction
    Replies: 22
    Last Post: 08-14-2008, 07:59 PM
  2. Forked leaf sundew madness!
    By LLeopardGGecko in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 18
    Last Post: 11-06-2005, 05:54 AM
  3. N. ventricosa for forked or king sundew
    By Captotterboy in forum Carnivorous Plant Trading Post
    Replies: 1
    Last Post: 06-16-2005, 09:45 AM
  4. Heres an update on my forked sundew
    By ccrider1016 in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 6
    Last Post: 10-27-2002, 10:40 PM
  5. Forked sundew?
    By schloaty in forum General Discussions
    Replies: 1
    Last Post: 07-19-2002, 07:00 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •