User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: D. erythrorhiza ssp. magna

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)


    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh, my! My tongue drags in the empty dust where should be growing one of these stunning plants .
    "Grow More, Share More"

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's really cool! How is that for cultivation difficulty? It looks like a cross betweena ping and a drosera! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Dec 2003
    Location
    hong kong
    Posts
    149
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    beautiful!
    I've just got some seeds,could somedody give me directions [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    thanks!

    rex


    hong kong cps gallery

  5. #5

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have never managed to germinate the seed. It might take fire stratification to get the seed to stratify. GA3 didn't work either.
    "Grow More, Share More"

  6. #6

    Join Date
    Dec 2003
    Location
    hong kong
    Posts
    149
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    william
    fire stratification is more strange to me
    It seems hard to produce the next generation by seeds [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

    rex
    hong kong cps gallery

  7. #7

    Join Date
    Apr 2004
    Location
    6 Vine St Taperoo 5017 South Australia
    Posts
    81
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Rex,
    If you see the amount of bushfire that happen in Australia you understand. you can try smoke water for germination. It paper disc impreganted with chemicals that are released during fires. And remember with all extra help it can take over 18 monthes for germination [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]

  8. #8

    Join Date
    Dec 2003
    Location
    hong kong
    Posts
    149
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    khoas,
    thanks for your informations [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    rex

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •