User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: Just a fun pic

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Lacewing meets D. binata multifida extrema

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nice pic. Laacewings are good bugs though Lol.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey, the lacewing did this to itself, I had no part other than taking the picture. As far as I am concerned the 'dew earned the meal and if the bug is too stupid to avoid getting eaten then that is just the way Darwin's dice fall
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    One has to wonder how the plant will be able to digest anything when all it has is wings, though.

    Nice pic!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's a neat photo.

    I've wondered about that as well. Sometimes craneflies get caught by the wing and I figure they won't really get eaten.

    A binata is a messy thing to fly into. Ugh.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Great pic Pyro. I wonder which fork will win the tug of war...let us know.

  7. #7
    Juan-Carlos's Avatar
    Join Date
    Aug 2004
    Location
    Miami, Florida
    Posts
    304
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Love that pic buddy!

    -Juan-Carlos
    Miami, Florida
    www.jcreef.bravehost.com
    Heliamphora ... A genus that intrigues me and fills me with joy!

    -Jc
    Miami, Florida

  8. #8

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Looks like its praying to be let go, lol. You can see the fear in its eyes...yeah whatever.

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •