User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: Just a fun pic

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Lacewing meets D. binata multifida extrema

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nice pic. Laacewings are good bugs though Lol.
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey, the lacewing did this to itself, I had no part other than taking the picture. As far as I am concerned the 'dew earned the meal and if the bug is too stupid to avoid getting eaten then that is just the way Darwin's dice fall
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    One has to wonder how the plant will be able to digest anything when all it has is wings, though.

    Nice pic! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's a neat photo.

    I've wondered about that as well. Sometimes craneflies get caught by the wing and I figure they won't really get eaten.

    A binata is a messy thing to fly into. Ugh.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Great pic Pyro. I wonder which fork will win the tug of war...let us know.

  7. #7
    Juan-Carlos's Avatar
    Join Date
    Aug 2004
    Location
    Miami, Florida
    Posts
    304
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Love that pic buddy!

    -Juan-Carlos
    Miami, Florida
    www.jcreef.bravehost.com
    Heliamphora ... A genus that intrigues me and fills me with joy!

    -Jc
    Miami, Florida

  8. #8

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Looks like its praying to be let go, lol. You can see the fear in its eyes...yeah whatever. [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •