User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: N. gymnaphora

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi all,

    I recently aquired this species, and the available info via google is slight.

    I did read that although this is technically a highland, it can adapt to lowland conditions (though I suppose not ultra-lowland). Anyone care to comment on this? Anyone ever grow this plant long period in lowland or intermediate conditions?

    Also, has anyone experimented with or know the low end limmit of required humidity levels?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    witzelsucht's Avatar
    Join Date
    May 2005
    Location
    Boulder Colorado
    Posts
    37
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. gymnaphora has a huge altitudinal distribution from lowland to very highland. Charles Clarke's book lists it as 600m - 2800m - hence the reports that it can "adapt" to lowland conditions. I don't know if most clones are adaptable to such a temperature range or if there are highland and lowland varieties in the trade. Hopefully others will have that answer. Most of the examples I have seen were growing in low highland altitudes (probably around 1000-1500m).

    I love gymnaphora's tubby lower pitchers and think it is highly underrated - probably because it is one of the most common species in Sumatra and Java.

    Rich

  3. #3

    Join Date
    Nov 2002
    Location
    Hampshire  UK
    Posts
    572
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi David
    Havent seen you about much lately,loads of additions to the collection i imagine??
    Bye for now julian

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Ches, Oh, I've been around - lurking. Mostly drive by log-ins. Been a LEEETLE bit busy at work!

    Thanks for the info, Witz.

    Now, anyone know how forgiving it is of lower humidity?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It can handle sustained humidity at 30% easily if mine is anything to go by. HAve not tried the lowland growing however.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Pyro.

    Looks like I may give it a go in my low/intermediate set up. Cools off at night to mid to high 60's, and humidity is usually over 50%. Worth a shot!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •