User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Build a nep

  1. #1
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Ok I made this Topic so people could tell others what their "dream nep" is. If you want to post say what it will look like, higland/lowland/intermedite, general facts and of course a name. Yes you get to name your own nepenthes, sort of. I'll start off with N. Flamenta. It will be a lowland species with the pitcher shape of an Alata with its color starting from the bottom with yellow then going up to orange the the rest black. The pitchers would be huge like a Raja's The persimtone does not curve inward, but as it loops over the rim it goes straight like a Hamata that has straightened "teeth". Its flowers are dark red.
    Post your neps here!
    Glider
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  2. #2

    Join Date
    May 2005
    Location
    Sweden
    Posts
    412
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mine would just be an Ampullaria as big as Rajah or Villosa
    Need all the experience I can get...

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh, this is fun!

    Nep 1 - I think I'd like the shape of the reinwartiana pitcher (or alata bochiana mimic) - you know, bulbous bottom, cylidrical middle and slighly flaired mouth...And with that nice, red color it gets. Then add the size of a truncata, adaptablility of a x 'miranda' (which, in my opinnion is even more adaptable than a ventrata). Top it off with the fangs of a bical, nectar production of my campanulata, and growth speed of a gracilis.

    Nep 2 - Since I'm a sucker for large pitchers, I would also have to be sized like a truncata, but more rounded...I guess like a merrilliana. Then, a wide peristome - not quite like a vetichii, but almost. Add the ridges of a macrophylla and the color scheme of an aristolochioides.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Those are pretty neat ideas. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pitcher shape and structure of N. jaq but with hamata's teeth and with truncata's size. Pitcher colour would be red with a purple peristome. Intermediate.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Sep 2004
    Location
    Florida
    Posts
    752
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My nep species is so awesome that if I were to describe, the universe will implode from how awesome it is. The only thing I can tell you is that it has teeth and eye spots. This is an artist's drawing of said nep, don't say I didn't warn you


  7. #7
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    haha PiranhaPlant [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  8. #8
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i think saw-shaped "leaves", like dandilions would be awesome.

    no tendrils that come directly out of the ground and no "leaves"

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •