User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: It's Time for Everybody's Favorite Game:

  1. #1

    Join Date
    Aug 2005
    Location
    LA, CA
    Posts
    32
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Folks,

    Finally after four months of light adding, humidity tweaking, "soil" mixing and prayer, my "highland hybrid" has produced a pitcher that hasn't shriveled up! Whoopie! Now comes the fun part: finding out what ingredients went in to creating this plant.

    Any takers?

    Happy holidays,

    -N

  2. #2

    Join Date
    Jul 2005
    Location
    Long Beach California
    Posts
    1,494
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Nanook @ Dec. 13 2005,9:14)]tweaking
    ha!

    well im in the same situation too. wow looks like you got uppers on this one. urs seems to be likw mine.
    if it is i hope the uppers look like that!

    BTW i grow this one outside with low humidity of 20% at times in full sun!





    \"Nepenthes, the Devil's Cup\" - Santos
    Updated 5/27/06 Grow/Want List
    Updated 4/4/06 My Nepenthes Photo Album
    Feel free to call me @: (562)528-6223 - seriously!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nanook,

    I am half inclined to ID it as a 'Miranda' but the pitcher shape is a bit funky for that.

    Fc, I don't think your's is the same as Nanooks
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FC, I don't think you have the same thing, either. Though yours looks very Miranda-ish...The only difference being that my Miranda has a "pointier" peristome, while yours has completely rounded edges.

    Nanook, yours looks suspiciously like my ventricosa x spectablis.....But I only have one pitcher right now, and it's not even open yet....So I'm not the best judge.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Jul 2005
    Location
    Long Beach California
    Posts
    1,494
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    u sure because mine is still in lowers. his are uppers and i stongly dissagree that there is ventricosa...
    \"Nepenthes, the Devil's Cup\" - Santos
    Updated 5/27/06 Grow/Want List
    Updated 4/4/06 My Nepenthes Photo Album
    Feel free to call me @: (562)528-6223 - seriously!

  6. #6

    Join Date
    May 2005
    Location
    Sweden
    Posts
    412
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I agree that there might be some ventricosa in that. But I dont think its with spectabilis. maybe something else..
    Need all the experience I can get...

  7. #7
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nanook, yours does look 'Miranda'-ish but i dont think it is. the uppers off mine werent as long and skinny they were more compact. but i didnt get to see to many uppers off of mine so i could be wrong. maybe its some other hybrid with 'Mixta' as a parent?
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •