User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 22

Thread: Ever topped off a rajah?

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Josh,
    I've heard (could be a wive's tale) that putting an apple in the encloser with a plant can help to stimulate flowereing.....Something about a chemical that an apple releases as it decomposes. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (schloaty @ Jan. 24 2006,2:38)]Hey Josh,
    I've heard (could be a wive's tale) that putting an apple in the encloser with a plant can help to stimulate flowereing.....Something about a chemical that an apple releases as it decomposes. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/confused.gif[/img]
    Ethylene is the chemical name you are looking for [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11

    Join Date
    Jul 2005
    Location
    Long Beach California
    Posts
    1,494
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    does it really work?
    \"Nepenthes, the Devil's Cup\" - Santos
    Updated 5/27/06 Grow/Want List
    Updated 4/4/06 My Nepenthes Photo Album
    Feel free to call me @: (562)528-6223 - seriously!

  4. #12

    Join Date
    Dec 2003
    Posts
    784
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (fc3srx713b @ Jan. 24 2006,8:30)]does it really work?
    I wouldn't know about Neps, but it certainly works to stimulate flowering in Bromeliads (including pineapples).
    Amori

  5. #13

    Join Date
    Sep 2004
    Location
    Sydney, Australia
    Posts
    703
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The proviso is that the plant has to be sexually mature for it to flower. It may not be quite at that stage yet, even if it is really big. If it is producing uppers, then it is ready to flower.
    Demystifying Nepenthes: http://www.nepenthesforeveryone.com

  6. #14

    Join Date
    Apr 2005
    Location
    Germany
    Posts
    19
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello,

    a rajah in flower can be seen here:

    http://www.fleischis.com/Bilderb....ni.html (you need to click twice "Weiter")

    It belongs to Johannes Marabini und reached this stage in about 10 years from a 2 cm seedling.

    Cheers,
    Dominik

  7. #15
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nice images dominic I'd love to wander through that GH! But I only saw a small rajah on the 3rd page, no flowers.

  8. #16
    白人看不懂 Drosera36's Avatar
    Join Date
    Aug 2004
    Location
    z5/6, Rochester, NY
    Posts
    2,017
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It's the pic right below the baby rajah.

    -Ben
    He who can, does. He who can't, teaches. -George Bernard Shaw
    I love these shirts!!!
    My Growlist
    My Webpage

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •