User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: N. species nova (Wistuba's plant)

  1. #1

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hey all. I'd just like to know if any of you guys 'n' gals who have this plant notice any temperature/humidity/light constraints for this one.

    I plan on growing it in a tank w/ eymae, sibuyanensis, and some other common species/hybrids. Anybody see any problems with this?

    Thanks in advance for your help!
    Check my growlist! Nothing currently available for trade...

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Do you mean spec. nova Sumatra?

    If so then this plant is pretty easy (at least for me under my conditions.) I have it with all my highlanders and it has not missed a beat since I recieved it, did not even stop pitchering.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yep, that's the plant I'm talking about (spec. is short for species).

    That is great news (better than my car insurance)!

    Has anybody seen the differences between Wistuba's three clones?
    Check my growlist! Nothing currently available for trade...

  4. #4

    Join Date
    Dec 2002
    Location
    Munich/ Germany
    Posts
    348
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My plants grow better during winter with lower night time temperatures. They are still young and so they didn't have problems with the hotter temperatures during summer.



    Joachim

  5. #5

    Join Date
    Sep 2005
    Location
    UK
    Posts
    19
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fast grower for me in typical highland conditions 12-25oC, 80% humidity, 10-12Klux


  6. #6

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Do you know which clone that one is?
    Check my growlist! Nothing currently available for trade...

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sweeeeet! I just picked this guy up at the NECPS show!!!

    SCHWING!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8

    Join Date
    Aug 2003
    Posts
    141
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Those plants are really nice!! How long have you had them? I may get some more but I grow them outdoors and being so small, they often don't do well. My other alternative is to grow them as windowsill plants. I may do that.

    Joel
    http://www.nepenthesaroundthehouse.com

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •