User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: temperature for highlands

  1. #1

    Join Date
    Jun 2006
    Location
    Atlanta, Ga
    Posts
    342
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Out of curiousity, how cold can highland neps take it? I don't plan on wintering mine outside, but sometimes i keep the window open when its below 50 or so outside to keep the apartment cool.
    Updated Growlist!

  2. #2

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Most highlanders will take temps as low as 50-60F and ultrahighlanders can take 40.
    Check my growlist! Nothing currently available for trade...

  3. #3

    Join Date
    Aug 2005
    Location
    Sarawak,Borneo Island
    Posts
    327
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    and the humidity for the day around 35%-40% and night around 70%-80%,given the right media your plant will be very happy

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have safely grown higlanders outside here (Stone Mtn) until the nights started dipping into the 40s.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Don't approach freezing temperatures, I've had many experiences with frost and Nepenthes, more hardy than you think!

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So long as you stay out of the 30's, you're fine.

    I even once left out a few of the hardier ones in a frost (by accident, and I DON'T reccommend this), and they were fine - didn't even get any of that wilted lettus look. Of course, these were a Miranda, vetrata and truncata x ventricosa - all known for their hardiness.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •