User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 20

Thread: Stripped peristomes

  1. #9
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmm... i guess its the same thing as us... why we have freckles or moles. they are mutations in skin cells right? or it just melanin? i think what the spots are from is the same stuff that gives VFTs their color....anocthianin?? did i spell that right?? . thats what i think...
    Alex
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  2. #10

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    freckles are caused by a larger quantity of melanin being expressed in a cell...not a mutant. And the chemical you're thinking of is anthrocyanin, which is only a red/purple pigment, so no, not all nep spots or VFT colors are caused by it
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]One could liken this to the maize example that you have already brought up, but, maize/corn are mutants, and so personally, I wonder as to if there is another factor in place in that regard.
    Maize is not a mutant any more than a dog is a mutant. It is just domesticated.

    Quote Originally Posted by [b
    Quote[/b] ]Peristome striping could be due to TEs, but personally, I think that might be a little too random.
    But that was the whole point, TEs are random. Very random.

    Quote Originally Posted by [b
    Quote[/b] ]I think that there is probably a mechanism in place here similar to what produces colors and shape of said colors in calico cats. You know, just 5 different genes or so that control it that in diff combinations give diff colors, no color, or that may be turned off and produce a "standard" color. Just a theory though...
    Presto covered this thoug I do want to note that the chromosome does not "shrivle up". It is still present and fully intact it is just that it has been "silenced" so that there is no expression from it.

    Quote Originally Posted by [b
    Quote[/b] ]very, very basically, they occur when part of the DNA strand breaks off at the very earliest stage of development. So, all cells that are created after this point are missing this part of the strand. in the case of corn, the strand contains a gene that blocks the brown color. so when the gene is gone, the brown color comes through.
    Close. Very very basically TEs are pieces of DNA that excise from the genome and then can re-insert somewhere else. depending on where they excise from or reinsert to epsression of genes can be changed (either up or down). And cells that are desended from a TE effected cell would express that trait. So going back to corn; if the TE excises in the first stage of seed development then the whole kernnel will be brown but if a TE excises later on in development then only cells derived form that precursor cell will be brown. Which is why there are kernnels that are brown/yellow stripped as well as all brown or all yellow.

    Quote Originally Posted by [b
    Quote[/b] ]I don't think this is how neps get their color, simply because each corn kernel is a seed...i.e., a different potential organism with a different genetic makeup from each other. the cells that divide (and potentially lose that TE) are different for each individual. if one kernel's earliest dividing cells retain the element, it will be yellow; if its neighbor's lose the element, it will be brown. but all the cells that originate from one spot will be the same color. in neps, all the above-ground cells originate from the shoot apical meristem ("growth point"). if transposable elements were at work, all the cells would have the same color pattern because they would all either have or lack the sequence.
    I see your point but the flaw in it is that you assume the TE moved during growth from the apical meristem. It need not and infact I was working from the point that it did not happen until much later. Obviously pitchers are made by expressing genes different than those expressed to make the "leaf" part of the plant. Until these genes are activated and until the cells expressing them are dividing then a TE can do what ever it wants. So, to make it a little more simple, the genes activated to make toes are different than those activated to make legs but they all come from the same place. And if some genetic modification happened only in the cell that would later give rise to your middle toe then your middle toe would look different than all the others. Never mind the fact that once upon a time it started way back with cells that gave rise to your leg. That is about what I am thinking happens in Neps, in the precursor peristome cells there are select, random populations that have some type of TE event and from those events you get stripes.

    Quote Originally Posted by [b
    Quote[/b] ]To me, it appears that most striped peristomes arise from the same mechanism that produces spots on the pitcher body. The key difference is that the peristome appears to grow linearly, so, rather than producing a spot it produces a stripe...

    So then the questions are: What controls spotting in Nepenthes pitchers and whether the spotting gows all the way up to the growing pint of the peristome as it develops.
    The TE argument could still work for this. Though I will mention that not all species with stripped peristomes have spots. N. veitchii, truncata, lowii and ephippiata are not spotted for example. And some spotted speices do not have stripes, like hamata and amp... Which also lends a slight TE suspect as different markation could imply different types of TEs moving around. And since a mojor part of every genome is composed of TEs that is not too far fetched.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Corn and maize are very much mutants. You know what corn and maize both look like now. When they first entered cultivation thousands of years ago, each head only had 2 kernals on it. Thanks to random mutation and selective breeding over thousands of years, they now have an entire head of kernals.

    And by me saying that they are too random...yes I realize thats the point, but they seem TOO random for nepenthes. Just because that is the mechanism in corn/maize does not mean it will be the same for nepenthes. Consider the orders of magnitude of complexity that nepenthes genetics has over corn/maize genetics. Though it MAY work by the same mechanism, you are assuming that since it works in an organism with n=10, it must be the same in an organism where n=40
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  5. #13
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]the chromosome does not "shrivle up". It is still present and fully intact it is just that it has been "silenced" so that there is no expression from it.
    well, maybe shrivel isn't the best word. but they condense to form little blobs called Barr bodies. they definitely separate from the rest of the chromosomes.

    Quote Originally Posted by [b
    Quote[/b] ]you assume the TE moved during growth from the apical meristem. It need not and infact I was working from the point that it did not happen until much later.
    Oh, I think I see what you're saying now. I was thinking if the very top cell of the shoot apical meristem had that mutation, then all cells derived from it (i.e., every cell the plant created afterwards) would also have the mutation. But you're right, the mutation could occur in the daughter cells...I guess my question is, at what point DOES it occur?

    (Edit: I think what's confusing me most about this is the first source I read. The wording seemed to imply that it was a one-time possible occurance, occuring shortly after fertilization. so the plant, from that very early stage, would either have the gene or not have it, and thus all the cells in the same plant would be identical in that respect. in the case of maize, this would produce kernels that were either brown or yellow. but my genetics book seems to verify what you're saying...that it could occur later in development, and be different from cell to cell.)

    That said...if it does indeed occur in the daughter cells, I could see TEs being a possibility for nep pitchers and peristomes. it's a definite maybe!

    Quote Originally Posted by [b
    Quote[/b] ]...since a mojor part of every genome is composed of TEs...
    whoa, slow down there. TEs have been discovered in some eukaryotes...but they're not a MAJOR part of ANY genome, let alone EVERY genome.



    On the subject of mutants: A lot of people think of the X-Men when they hear the word "mutant" - a freak of nature, possibly artificially caused. In actuality, a "mutation" is a change in the DNA sequence, through any one of several means. It actually occurs quite commonly. So basically, every organism on Earth that evolved from the earliest primordial life is a result of mutation.
    -Emily

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]Corn and maize are very much mutants.
    I see what you are saying but I disagree. Using your argument every domesticated veggie/fruit/animal is a mutant. I call it selective breeding for desirable traits. Semantics I guess.

    Quote Originally Posted by [b
    Quote[/b] ]When they first entered cultivation thousands of years ago, each head only had 2 kernals on it.
    Again, it has been a while for me but I believe that wild maize actually had 4-6 kernnels that grew on only one side of the "cob" and the kernnels were about 2-3 times larger than what we see on traditional corn. And wild maize still exists. there was talk a while back about crossind commercial corn/maize back with ancestral stock to regain some of the disease resistance lost. The farm industry shot the idea down though as it reduced yeild per cob.

    Quote Originally Posted by [b
    Quote[/b] ]Just because that is the mechanism in corn/maize does not mean it will be the same for nepenthes.
    Actually yes it does. The mechanism for TE excision/insertion is pretty much universal so it does not matter what the TE is in be it bacterium, maize, Nep or human. All that really matters is where the TE jumps into/out of. In this case, discussing the possibility of a TE inserted into the pigment gene for peristomes, the mechanism would be probably be almost identical to that of maize. So the only factor you really have to take into account is the transposition rate which is higher than the mutation rate of DNA by 3-6 orders of magnitude. And personally I feel that covers the "TOO random" part.

    Quote Originally Posted by [b
    Quote[/b] ]Consider the orders of magnitude of complexity that nepenthes genetics has over corn/maize genetics. Though it MAY work by the same mechanism, you are assuming that since it works in an organism with n=10, it must be the same in an organism where n=40
    The magnitude of genetic complexity make little or no difference (actually that is not quite correct, the more genetic material then ususally the more TEs are present. But that is beside the point). The point is that the mechanism is constant through out. It is simple: a TE inserts into a region of a gene, any gene, and alters the expression (either up or down). At some point in the future that TE jumps and the gene reverts to its normal expression pattern. It make zero difference if the gene is one for colour or one for cytochrome C production, the mechanism of TE insertion/excision is always the same.

    Quote Originally Posted by [b
    Quote[/b] ]well, maybe shrivel isn't the best word. but they condense to form little blobs called Barr bodies. they definitely separate from the rest of the chromosomes.
    Yes, the Barr bodies. But they are not seperated from the other chromosomes and they are minimally active. They are just mostly permanently condensed as opposed to the other chromosomes which are partially/temporally condensed.

    Quote Originally Posted by [b
    Quote[/b] ]
    Quote Originally Posted by [b
    Quote[/b] ]
    ...since a major part of every genome is composed of TEs...

    whoa, slow down there. TEs have been discovered in some eukaryotes...but they're not a MAJOR part of ANY genome, let alone EVERY genome.
    At the risk of sounding like a pompus ****, be careful when arguing genetics with a geneticist

    But you are partially correct and I was rash saying that TEs are a major part of every genome. However, to date, every sequenced organism has had at least some type of TE present so I was correct in saying they are in every organism. And typically as the size of the genome increases so to does the persentage of the genome that is TEs (with a few exceptions such as the honey bee). So if you look at it in order of increasing size, in E. coli TEs compose 0.3% of the genome, in C. elegans it is 12%, in D. melanogaster it is 15-22%, in humans it is 45%, in maize it is 60% and the frog R. esculenta it is 77%! Now I guess it comes down to personal definition but in my book 12%+ is a pretty "major" fraction of the genome. But even if you do not agree with me on that point you have to admit that 45%-77% of the genome is major.

    Quote Originally Posted by [b
    Quote[/b] ]In actuality, a "mutation" is a change in the DNA sequence, through any one of several means. It actually occurs quite commonly. So basically, every organism on Earth that evolved from the earliest primordial life is a result of mutation.
    And by that same token every individual of any species is a mutant because no two individuals are truely genetically identical what with SNPs and alleles and all And that is why I say maize is not a mutant any more than a dog is a mutant. But to each their own...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]and the frog R. esculenta it is 77%!
    see, this is EXACTLY why those guys at Jurassic Park should've just used a chicken.
    -Emily

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Presto @ Nov. 14 2006,9:34)]see, this is EXACTLY why those guys at Jurassic Park should've just used a chicken.
    LOL
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •