User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 20

Thread: Stripped peristomes

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So I was reading one of my backlogged Nature issues while waiting on an experiment to finish and one of the articles got me thinking... Are transposable elements the cause of stripping on Nep peristomes? I mean, the expression is pretty random. Kind of like McClintock's maize...

    Just my random thought for the day.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh ... I was expecting something a little more provocative after reading stripped peristomes and jumping jeans. Oops, that was jumping genes.

    Is the mechanism of randomly striped peristomes similar to what causes random variegation on leaves or random stripes on zebras?
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (herenorthere @ Nov. 10 2006,7:51)]Is the mechanism of randomly striped peristomes similar to what causes random variegation on leaves or random stripes on zebras?
    Hey Bruce,

    Sorry to disappoint, I was justtrying to drum up some talk on what I thought was an interesting idea.

    I don't know the mechanism of variegation but I think zebra stripping is probably a well regulated series of genetic events.

    Because the stripes on Nep peristomes seem to be totally random I was thinking it sort of followed a similar character to the TEs in maize.

    I could easily be way off base, it is just a strange thought that popped into my head. If anyone is doing Nep genetics they could probably figure it out fast enough though. Not that I imagine many people are doing Nep genetics...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    throckmoron's Avatar
    Join Date
    Jul 2006
    Location
    Austin, TX USA
    Posts
    169
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Isn't there a billionaire Nep. freak somewhere who would want to give grants to plant geneticists to study Nep. jeans?

  5. #5

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hmm...this is an interesting idea.

    One could liken this to the maize example that you have already brought up, but, maize/corn are mutants, and so personally, I wonder as to if there is another factor in place in that regard.

    Peristome striping could be due to TEs, but personally, I think that might be a little too random. I think that there is probably a mechanism in place here similar to what produces colors and shape of said colors in calico cats. You know, just 5 different genes or so that control it that in diff combinations give diff colors, no color, or that may be turned off and produce a "standard" color. Just a theory though...
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  6. #6

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ] I don't know the mechanism of variegation but I think zebra stripping is probably a well regulated series of genetic events.
    One of Gould's essays covers it; apparently all zebra embryos get stripes of the same width. In some species, however, it occurs later, so the embryo is longer, and thus has more stripes. As the zebra embryo grows, the stripes get distorted and such.

    Dunno about the neps, though; genetics and developmental biology are pretty far outside of my expertise.

    Mokele
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

  7. #7
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I had to look up TEs...I very vaguely remember learning about them in Genetics. very, very basically, they occur when part of the DNA strand breaks off at the very earliest stage of development. So, all cells that are created after this point are missing this part of the strand. in the case of corn, the strand contains a gene that blocks the brown color. so when the gene is gone, the brown color comes through.

    I don't think this is how neps get their color, simply because each corn kernel is a seed...i.e., a different potential organism with a different genetic makeup from each other. the cells that divide (and potentially lose that TE) are different for each individual. if one kernel's earliest dividing cells retain the element, it will be yellow; if its neighbor's lose the element, it will be brown. but all the cells that originate from one spot will be the same color. in neps, all the above-ground cells originate from the shoot apical meristem ("growth point"). if transposable elements were at work, all the cells would have the same color pattern because they would all either have or lack the sequence.

    the short answer is, I don't think it's the same mechanism at work.....but now I'm wondering if the whole Drosera adelae white-flower-turned-red phenomenon has something to do with TEs.....

    calico cats I can explain! I thought this was really interesting. female cats, like female humans, have two X chromosomes. but, most cells don't NEED two X chromosomes. so one will shrivel up and the other one will be used for gene expression. which one of the two is random from cell to cell. now, it also happens that the orange-or-black gene is on the X chromosome of cats. so, some female cats will have the gene for orange fur on one X chromosome, and the gene for black fur on the other. so if the chromosome with the 'black' gene shrivels, that cell will express 'orange', and vice-versa. because it's random which of the two genes is expressed, the cat will have a 'mosaic' pattern - i.e., a tortoiseshell cat (crazy orange/black coloration). cats also have a gene for white bellies on one of their other chromosomes - males or females can have it. calico cats are female cats that both have the orange & black tortoiseshell makeup, plus have the gene for white bellies as well.

    as far as neps...I have no clue.
    -Emily

  8. #8
    witzelsucht's Avatar
    Join Date
    May 2005
    Location
    Boulder Colorado
    Posts
    37
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    To me, it appears that most striped peristomes arise from the same mechanism that produces spots on the pitcher body. The key difference is that the peristome appears to grow linearly, so, rather than producing a spot it produces a stripe.

    If you look at the base of the peristome where it meets the pitcher body, you will typically see a red spot merging with the red stripe on the peristome.

    So then the questions are: What controls spotting in Nepenthes pitchers and whether the spotting gows all the way up to the growing pint of the peristome as it develops.

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •