User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: please help id this nep

  1. #1

    Join Date
    Apr 2006
    Location
    West Palm Beach, Florida
    Posts
    48
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi all,
    wife bought me a new nep for my b-day (40th) from a local nursery and Im not sure what it is so Im hoping you can help:

    http://i79.photobucket.com/albums/j1...p/DSC00055.jpg

    http://i79.photobucket.com/albums/j1...p/DSC00054.jpg

    http://i79.photobucket.com/albums/j1...p/DSC00052.jpg

    Im guessing maxima.
    I have it getting morning sun only hanging in covered patio, is this enough?
    Thanks!

    So far Im not having much luck w sundews in S Fl, however my flytraps and sars are doing great (if I can keep the caterpillars and birds away from them).
    Thanks!

  2. #2

    Join Date
    Apr 2006
    Location
    West Palm Beach, Florida
    Posts
    48
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    plz? thats is not at all what I wrote in the subject line, weird!

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    HI MD,

    I edited your thread topic, I hope you don't mind.

    My best guess it that it's N. x 'Gentle.' It's not Miranda, as the peristome isn't right, but it's otherwise so similar - it also looks almost exactly like my gentle, but mine is smaller, so I'm not 100% sure.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am going to have to disagree with Dave. That is definitly a 'Miranda'
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. X Miranda, surefire. Has a bit more N. northiana influence in it. I'm moving this to the ID plants forum as well.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •