User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: Houseplant idea...

  1. #1
    Meaven's Avatar
    Join Date
    Aug 2006
    Location
    Minnesota
    Posts
    211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i love neps so much, i want to give them as gifts. but obviously, its not worth giving to someone who doesnt have a terrarium to keep it healthy.

    so i was thinking of maybe making a rig... some sort of stand (think wrough iron barstool) to sit a nep pot on, and then have an adjustable arm going up over it, which will house a compact flourescent bulb with an adjustable timer switch.

    would a single compact flourescent (high wattage, of course) be enough for the easier of neps (like ventricosa, etc)? would this setup be practical?
    if i were ruler of the world, anyone who defined a nepenthene as a "companion plant" to orchids would be fired from a cannon atop mt. kinabalu.

  2. #2

    Join Date
    Jun 2006
    Location
    Atlanta, Ga
    Posts
    342
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    terrarium? I grow ventricosa, sanguinea, fusca, spectabilis, bical, and "black dragon" over on my windowsill....

    The first two are were my first and have gone from a 3" to a 6" pot in 8 months...

    I think if you are looking for "practical" hand them a ventricosa and have them stick it in a window...
    Updated Growlist!

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Meaven, depending on how close to the light you have the plant, it sounds reasonable.

    To make a truly educated reply, though, I'd really need a picture of what you propose, as well as your year-round environmental conditions (temp & humidity).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    Meaven's Avatar
    Join Date
    Aug 2006
    Location
    Minnesota
    Posts
    211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well, i'd try it at my house first. it would pretty much always be eh, 30% to 50% humidity (minnesota summers are crazy) and between 70 and 80 degrees.

    at my house, i dont have a lot of windows that get decent sun. and with it being winter, my windowsills sit at around 40 to 50 degrees, so i need to think of a better option.
    if i were ruler of the world, anyone who defined a nepenthene as a "companion plant" to orchids would be fired from a cannon atop mt. kinabalu.

  5. #5
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Meaven @ Dec. 07 2006,10:09)]at my house, i dont have a lot of windows that get decent sun. and with it being winter, my windowsills sit at around 40 to 50 degrees, so i need to think of a better option.
    Well, remember these gifts will not be for you windows at your house. Just think about your recepients home and maybe suggest a location. In my experience, those neps listed would be good candidates for a window.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    As with what others are saying I advocate considering windowsills. Look at my growlist, anything on there that is not a full blood highlander is in a windowsill here for the winter and all grow and pitcher fine.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]well, i'd try it at my house first. it would pretty much always be eh, 30% to 50% humidity (minnesota summers are crazy) and between 70 and 80 degrees.

    at my house, i dont have a lot of windows that get decent sun. and with it being winter, my windowsills sit at around 40 to 50 degrees, so i need to think of a better option.
    Living in south dakota, a rougher climate than you, id say NO windowsills. The temperature extremes during the winters and summers are too great that close to the glass (i assume you have ice forming on the inside of your windowpane in winter too?) unless you have a very wide windowsill. The people who can do this live in mostly milder climates
    that makes no logic

  8. #8
    Meaven's Avatar
    Join Date
    Aug 2006
    Location
    Minnesota
    Posts
    211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Finch @ Dec. 07 2006,10:15)]
    Quote Originally Posted by [b
    Quote[/b] ]well, i'd try it at my house first. it would pretty much always be eh, 30% to 50% humidity (minnesota summers are crazy) and between 70 and 80 degrees.

    at my house, i dont have a lot of windows that get decent sun. and with it being winter, my windowsills sit at around 40 to 50 degrees, so i need to think of a better option.
    Living in south dakota, a rougher climate than you, id say NO windowsills. The temperature extremes during the winters and summers are too great that close to the glass (i assume you have ice forming on the inside of your windowpane in winter too?) unless you have a very wide windowsill. The people who can do this live in mostly milder climates
    yeah sometimes the ice gets up to a half inch thick =P
    if i were ruler of the world, anyone who defined a nepenthene as a "companion plant" to orchids would be fired from a cannon atop mt. kinabalu.

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •