User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: Nepenthes lingulata - Introducing a New Species

  1. #1

    Join Date
    Aug 2002
    Posts
    518
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here are some photos of Nepenthes lingulata, a newly described highland species from North Sumatra, Indonesia. Discovered by Ch'ien Lee, this species is characterised by the long appendage beneath the lid, which hangs down towards the mouth of the pitcher.

    The name 'lingulata' is derived from 'lingula', the latin name for tongue.

    This species is in cultivation.

    More and better photos will be available soon on Ch'ien's website www.wildborneo.com.my

    PLEASE NOTE - these photos are copyrighted. Please contact either Ch'ien or myself if you wish to reproduce them.


    Appendage Beneath Lid


    Plant in Habitat


    Group of Upper Pitchers in Habitat


    Pair of Upper Pitchers in Habitat
    Rob Cantley
    Nep Nut in Sri Lanka
    http://www.borneoexotics.com

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice. I personally like the dark colouration. Is that typical for all the plants??
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Meaven's Avatar
    Join Date
    Aug 2006
    Location
    Minnesota
    Posts
    211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    thats definately interesting, i definately adore black pitchers.

    you could spent a lifetime figuring out why certain neps evolve the way they do, as opposed to others.

    why does hamata have teeth? why does edwardsiana have frills? these appear fairly obvious- nectar drips from the tip of the appendage, causing bugs to fall off, like bicalc. but why are bicalcs sharp and short, and this is long and dull? this is what fascinates me the most about these plants.
    if i were ruler of the world, anyone who defined a nepenthene as a "companion plant" to orchids would be fired from a cannon atop mt. kinabalu.

  4. #4
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Looks like an N. ramispina mutant! Very cool!

  5. #5
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    God... why do all the best plants live in the highlands!

    Time to get a highland chamber!


    Do you know if they are hard like N. bicalcarata or relatively soft like th tissue of the pitcher itsself?

  6. #6
    quogue's Avatar
    Join Date
    Aug 2006
    Location
    Long Island, NY
    Posts
    773
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Meaven @ Jan. 10 2007,6:53)]thats definately interesting, i definately adore black pitchers.

    you could spent a lifetime figuring out why certain neps evolve the way they do, as opposed to others.

    why does hamata have teeth? why does edwardsiana have frills? these appear fairly obvious- nectar drips from the tip of the appendage, causing bugs to fall off, like bicalc. but why are bicalcs sharp and short, and this is long and dull? this is what fascinates me the most about these plants.
    My first thought was that they're for hooking onto other vegatation and vines to help the plant climb.
    Thanks for introducing me to this fantastic new plant Borneo!

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nep G, I was going to say the same thing. Very reminicent of ramspina.

    Nice plant.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually much more like N. singalana. The peristome and pitcher opening is significantly different on N. ramispina. Very nice and bizarre indeed ;>
    Tony
    Is that a Nepenthes in your pocket or you just happy to see me?

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •