User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: NEW nepenthes tenax!

  1. #1

    Join Date
    Jan 2007
    Posts
    14
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    NEW nepenthes tenax!

    --------------------------------------------------------------------------------
    A quote from a dude you kicked out... regret it now? he does have some quality stuff!

    "Just reading through the paper I was sent on Nepenthes Tenax it says that a small form was found with pitchers 50mm heigh x 8mm wide acordinglee the species with the smallest ariel pithcer of the genus (but are usually half the size) and the stem rarley reaching over 150mm (15cm) in height with infloresents of 100mm, found in VERY swampy areas.

    the normal form apparently is a self supporting stem to 1meter high with pitchers rarley exceeding 15cm, this plant shares habbitat with Nepenthes rowanea and mirabilis and already two hybrids have been found.

    excellent now why is it not floating around collections yet?"

    That was from matti, on an Aussie forum http://www.auscps.com/modules/newbb/

    I must say Im very happy about this! New aussie species...Move over Borneo, Australia is the new hot spot for nepenthes biodiversity! :P

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    No one regrets kicking Matti out. He was a racist and a bigot. He blatantly posted that Aboriginies (which he used the "N" word for) were less than human and it should be okay to murder them with out consequence. Not acceptable on this forum and not acceptable in society. After being banned for that he went on a 3 year old temper tantrum slam fest.

    Before he was banned, and after he snuck back on, he would start fights with people and was dead sure he was right about everything even when all evidence was against him. He would argue with people who are probably world experts and tell them flat out that they were wrong.

    When people tried to point out to him that his behavior was not acceptable, rather than listen he would answer with a 4-letter word.

    That Matti is repeating what someone else said does mean he has anything quality to say, it means he is a parrot and vain glorious to boot.

    For Matti to say anything quality it would have to be:

    1) A general apology posted on this board addressed to all the members saying he acknowledges and admits his past actions and offenses and is truely sorry for them.

    2) A specific apology to each and every Mod and member that he personally attacked

    And, to be perfectly honest, I don't see that ever happening. Matti is pompus, arogant and a brat. He was banned for a reason and that reason still stands. He has nothing positive to contribute here. He is not wanted here. And he needs to recognize that, respect that and move on.

    Unfortunatly, the word respect does not seem to be in Matti's vocabulary so I suspect we will more than likely have to deal with his infantile behavior for some time. I have said it before and I say it again now: Let the mule bray, I could not care less.

    I refuse to acknowledge Matti. I advocate that others do the same.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Beautiful rant, 'Ro! Brought a tear to my eye...
    Couldn't have said it better myself.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Matti is an utter bone head full of hot gas. He brag all he wants, no one will listen. All he s is dust in the wind.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •