User Tag List

Informational! Informational!:  0
Likes Likes:  1
Page 6 of 8 FirstFirst ... 2345678 LastLast
Results 41 to 48 of 59

Thread: Interesting seed germination instructions

  1. #41

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I didn't dodge your question at all, I said of course it's ok. I don't mind you answering questions at all. I don't know why you feel that I "challenged" you, because I didn't. In fact, this was between Rob and I, until you felt it your moral duty or some other such nonsense to jump in on behalf of everyone else, or at least that's the idea you're insinuating. So even though you're opposing my views and whatnot, I'd like to thank you mr. crusader on behalf of everyone else.

    Its absolutely fine for you to question and challenge me if you want, but I think you're missing the point that there is a difference between challenging someone's views on something, and trying to dissect every single word. One of those is benefical and helps the greater good, the other is straight up annoying. While you did raise a good point or two, most of your abitrary dissection of every single word falls under the latter.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  2. #42

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    PK, you can't really accuse Pyro for dissection, because that is what you did to Dave's instructions. Well, you can, but that would be hypocritical.
    Or did you not dissect and separated each point to make your objection, IYO, on that particular point? Well Pyro did the same thing there.
    So is it dissection and nitpicking, or is it challenging the post? I guess it's up to the individual to decide.




    I had no idea what I would be starting by introducing this thread.

    Cheers,

    Joe
    Last edited by The Griffin; 08-13-2007 at 09:38 AM. Reason: mispelled word

  3. #43

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Some of pyro's dissection was good when it was actually challenging a point. When it comes down to debating every single written word...well we can speculate each other to death.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  4. #44
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by phissionkorps View Post
    I don't know why you feel that I "challenged" you, because I didn't.
    You argued that things I said were wrong, irrelivant, innacurate, etc. That is a challenge. Unless of course I just decide to ignore it but I have seen what happens when someone does not take the time to address a point you make. You bring up the fact that they did not address it at a later date and then try to warp that around against them.

    In fact, this was between Rob and I
    So let me understand what you are insinuating... A post on a public forum that was started by someone else and contributed to by many others and it is only between you and Rob? What happened to:

    Is it alright for you or anyone else to do whatever they want...because it's the INTERNET.
    I guess it is only okay to post in a thread when it suits your means.

    until you felt it your moral duty or some other such nonsense to jump in on behalf of everyone else, or at least that's the idea you're insinuating.
    No that is not what I am insinuating (I do not think that word means what you think it means.) I jumped in with a simple comment on how I knew someone with years of personal experience and knowledge on the matter as well as the education to back it up had personally used the dark method. I was not crusading or jumping in on someones behalf. I was constructively contributing to the conversation. You still relegated that to "armchair" knowledge. Challenge made. I replied, challenge met. And here we are.

    So even though you're opposing my views and whatnot, I'd like to thank you mr. crusader on behalf of everyone else.
    Ah, name calling. The sign of a true intellectual


    I am bowing out, this is as pointless and futile as arguing with the southern end of a north bound mule. And I'd rather not see this thread become another case of Godwin's Law.

    Good day sir.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #45

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    nvm i don't feel like carrying this on
    Last edited by phissionkorps; 08-13-2007 at 10:58 AM. Reason: text deleted
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  6. #46
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    When you plant exactly 30 seeds of the same exact cross in two different pots and place them in the same exact humidity and temperature, but one pot is right next to lights, and the other is in a shady corner, and you get germination in the pot that was right next to the lights, but none in the pot that was in shade....well that's pretty conclusive.
    I have to point out here, that you say the same temperature. Were those temps measured at soil level? My bet is that the shady seeds were actually quite a few degrees cooler than the bright ones - lights do tend to give off heat.

    I bet it's the heat that gave you the germination, not the light.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #47

    Join Date
    Aug 2002
    Posts
    518
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    When you plant exactly 30 seeds of the same exact cross in two different pots and place them in the same exact humidity and temperature, but one pot is right next to lights, and the other is in a shady corner, and you get germination in the pot that was right next to the lights, but none in the pot that was in shade....well that's pretty conclusive.
    You beat me to it schloaty! Temperature.

    PK, at one time you told me I should take Basic Genetics 101, maybe you should consider Basic Science 101. To get conclusive results from any scientific experiment of this sort you need a control, which is entirely lacking. You have said elsewhere that your temperatures and humidity vary wildly, or similar wording. Also, as has been pointed out by Pyro, it's rather difficult to run any sort of statistical study with n=1. Yes, there may have been 30 seeds in each pot but they are treated as 2 batches. Any pathogen or environmental condition in either pot that inhibits germination will affect all 30 seeds in that pot.

    Your "pretty conclusive" result with 2 pots is therefore practically meaningless IMO. Sure, it's an experience worth posting if you wish, but not sufficient evidence to come out and dissect and then shoot someone else's ideas down in flames.

    Schloaty's comment about the temperature is the first thing that occurrred to me too. Also, if you are not keeping the pots at a constant temperature and if they are covered, there will probably be condensation in the shady pot. Ever heard of "damping off"? The fungi that cause this can wipe out seedlings so fast that you may be fooled into believing they never germinated at all unless you get your magnifying glass out.

    Sorry, don't buy it. Your experience in this case is not sufficient evidence to come out and dissect and demolish someone elses ideas. If, as an academically qualified scientist, you think your 2 pots constitute a valid scientific experiment, then well, words fail me....
    Rob Cantley
    Nep Nut in Sri Lanka
    http://www.borneoexotics.com

  8. #48
    Moderator Cindy's Avatar
    Join Date
    Aug 2001
    Location
    Singapore
    Posts
    2,435
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Update!!

    There is germination in both boxes!

    The box under light has got a patch of algae which I will remove later but generally there are at least 2-3 seeds which germinated over the past week. I'll monitor and let all of you know if the conditions encourage different rates of germination.
    Cindy

Page 6 of 8 FirstFirst ... 2345678 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •