User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 20

Thread: Come on people, lets get some pics out there!

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by schloaty View Post
    Huy, great shots. I think your unknown is a 'Miranda.' Could be 'Gentle,' but it those uppers look just like the first uppers on my 'Miranda.'
    Pretty lackluster 'Miranda' if it is, even in the lowest light mine has cherry red peristomes and significantly more spotting on it... I am thinking it is something else... Not sure what though
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    wmgorum's Avatar
    Join Date
    Mar 2007
    Location
    Little Rock, AR
    Posts
    230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Man, that N. x Dyeriana is BEAUTIFUL! I'd do A LOT to get a cutting from a plant like that... LOL

  3. #11
    huy716's Avatar
    Join Date
    Oct 2002
    Posts
    315
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,
    I got it from a grower which said to be a maxima x ? but i can't really ID it. Just for Identifying, my plant is slightly hairy on the leaves and steam; does 'Miranda' have that characteristic?


    Wmgorum,

    I got the plant last year and it took half a year for it to accustom to my condition and it is currently in blooming now. I was thinking of cutting in about a year so i will post here if i ever do cut it.

    Jeff
    We can go for days without food, but we can't pass 5 minutes without air. REMEMBER TO BREATH!!!

    Trouble breathing? Let me know.

  4. #12
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro, you may be right - I'd need to see a lower to be sure. My uppers have lost a lot of color. The "true" uppers have lost almost all of their coloration, while the lowers maintain their vivid reds. It's really a pretty cool contrast on one plant!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #13
    Someday is not a day of the week. Maxx's Avatar
    Join Date
    Aug 2007
    Location
    South-ern California
    Posts
    280
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Curtesii looks very similar to this Marbled Dragon.

    Last edited by adnedarn; 09-12-2007 at 06:02 PM. Reason: fixed img code
    I regret little to nothing!

    My Growlist

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    (tobica x ovata) x veitchii



    'Black Dragon'



    hamata



    'Ile de France



    'Miranda'





    'Sabre'



    truncata x lowii



    veithcii "lowland stripped"

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And I can not take credit for growing these but they are nice shots so I am adding them for that reasdon alone

    truncatas at ABG



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by huy716 View Post
    Pyro,
    I got it from a grower which said to be a maxima x ? but i can't really ID it. Just for Identifying, my plant is slightly hairy on the leaves and steam; does 'Miranda' have that characteristic?

    Hey Jeff,

    Well if it is maxima x ? it could be anything. 'Miranda' does not have hairy leaves/stem though so I think it is safe to say it isn't 'Miranda'. It is still a nice (and nicely grown) plant
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •