User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 22

Thread: N. Izumiae - how hard to grow?

  1. #9
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    no no no no!! the tag said they were 14.99. so i bought it....for 15$ because Richards partner said to go by the tag....then Richard said to go by the sheet(after i bought it) making it 25$(or....something like that) so he cut off the tops of all the tags so it had no price on it...thats the story...

    Alex
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  2. #10
    Nepenthesian Nepfreak's Avatar
    Join Date
    Aug 2007
    Location
    MA, USA
    Posts
    768
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    oopsies. Just sent them a message. lol. I hope I talked to a machine.
    It was a polite question, not a demand or anything like that :smile:

  3. #11
    Nepenthusiast's Avatar
    Join Date
    Jul 2007
    Location
    MA, USA
    Posts
    264
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    oops!
    Sorry, its just a little funny.

  4. #12
    Nepenthesian Nepfreak's Avatar
    Join Date
    Aug 2007
    Location
    MA, USA
    Posts
    768
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LOL. IMO it's a lot funny. Ok, all's good, they don't hate me (yet) They emailed me back and told me what glider told me.
    Last edited by Pyro; 10-04-2007 at 07:42 AM. Reason: Removed vendor name

  5. #13
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Don't you guys go messin' with them - I'll have to set the ninjas on you!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #14
    Nepenthusiast's Avatar
    Join Date
    Jul 2007
    Location
    MA, USA
    Posts
    264
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wait, aren't we not supposed to mention CP buissnesses? Schloaty, your a mod, you should know better!

    Or has the rule changed?
    Last edited by Pyro; 10-04-2007 at 07:43 AM. Reason: Removed vendor name

  7. #15
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    No the rule has not changed. And just because everyone else was doing it does not mean you hould do it too Especially after pointing out it was against the rules
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #16
    Nepenthusiast's Avatar
    Join Date
    Jul 2007
    Location
    MA, USA
    Posts
    264
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Pyro View Post
    No the rule has not changed. And just because everyone else was doing it does not mean you hould do it too Especially after pointing out it was against the rules
    Well you can't blame me for that! If a moderator doesn't change something it's logical to assume that they don't care and that the rule has changed!

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •