User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: whats an intermediate with large pitchers?

  1. #1
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    whats an intermediate with large pitchers?

    ive got a bit of grow room now and am thinking about getting a nep that actually gets large pitchers.........got a neps that are big but they dont get large pitchers........species, hybrids....doesnt matter but i like colorful
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #2

    Join Date
    Jun 2007
    Location
    Seattle, WA
    Posts
    102
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N. X "Black Dragon" Grows well on my intermediate windowsill.

  3. #3
    Nepenthesian Nepfreak's Avatar
    Join Date
    Aug 2007
    Location
    MA, USA
    Posts
    768
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    truncata highland seems to be doing fine on my intermediate sill. And they get HUGE. Black Dragon does too. You could also do rafflesiana if you're patient, mine took a hit when I moved it to the windowsill and stalled a few months but then bounced back with good growth. Miranda, Sanguinea and maxima are also good candidates.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Have you thought about N. x "Miranda?" This plant will grow anywhere.

    At the NECPS show I saw TWO Miranda pitchers that rivaled truncatas. No joke. They were at LEAST 14 or 15" tall (counting the lid).

    I, myself, have not been able to get one over a foot, but even that is pretty impressive.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I will cast my vote in for 'Miranda' as well. Well grown specimens at ABG break 18" pretty easy.

    I can also suggest 'Ile de France' as mine just fired out a pitcher that is easy a foot in height.

    Might be able to hook you up with the prior too if you are interested
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    srduggins's Avatar
    Join Date
    Aug 2004
    Location
    so. cal.
    Posts
    668
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    maxima x truncata
    thorelii x truncata
    alata x truncata
    ventricosa x truncata

    would be my top choices.


    -- notice a theme here?
    A day without Nepenthes is like a day without sunshine

    --steve

  7. #7
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i can quite put my finger on it but i think i see a pattern
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  8. #8
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    That's true, 'Miranda' would work... I just chopped the heck out of mine, so the pitchers of existing vines seems to have set back a little... But here are some older pics of the pitchers

    My plant before copping it up:


    Lower




    Upper after moving plant to rafters



    Upper before moving plant to the rafters



    Dunno how it compares to others, but I'd consider them good sized pitchers.
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •