User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 20

Thread: ? about raff x ? seeds from tropics

  1. #1
    Zero's Avatar
    Join Date
    Aug 2005
    Location
    Dark side of the Moon
    Posts
    1,299
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    ? about raff x ? seeds from tropics

    I received some rafflesiana x ? seeds (I think from tropics) a while back.
    He posted what plants the male pollen may have come from. Does anyone remember or have a link to that? I should be able to identify the male from the look of the plants when they grow up.
    these are the only nep seeds to sprout for me so far. they seem to be growing well even though I made the mistake of planting them in dried lfs that is now very live and growing so much I have had to trim it so the seedlings don't get buried.
    thanks,
    Zero
    SK-8 OR DIE

    growlist

  2. #2

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have no idea what the cross was....but use peat next time
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually those seed were from me

    IIRC the order of likeliness for the seed was: raff, bical, trunc, alata based on proximity to other flowering plants in the greenhouse.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Zero's Avatar
    Join Date
    Aug 2005
    Location
    Dark side of the Moon
    Posts
    1,299
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yeah, it was you come to think of it.
    thanks. I REALLY need to start keeping better records.
    the seeds had a high germination rate
    peace,
    Zero
    SK-8 OR DIE

    growlist

  5. #5

    Join Date
    Aug 2003
    Posts
    1,163
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Pyro,
    It may be any combination of those potential pollen donors!
    Zero, you may find you have an assortment of raff hybrids using the listed males.

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, Trent you are correct, it may be all those possible males got some pollen over to the female.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Guys,

    I had some of that seed - and despite me mis-treating them, I wound up with five very healthy plants. I've traded away one or two, but I still have the others.

    They're already 3" across!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    3 inches......wonder what my problem is?...............could be the 20 some seedlings all in a 4 inch pot......what do you think?
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •