User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 5 FirstFirst 12345 LastLast
Results 17 to 24 of 35

Thread: pics of nep seedlings, thanks pyro:)icps

  1. #17
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by zero View Post
    are those the huge plants in the LL greenhouse?
    if so I saw them last year.
    Yep, those are they. Biggest pitcher I have seen on them was probably 60cm I would guess. Resting on the ground it came up to my daughter's sternum.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #18
    BuddhistAdam's Avatar
    Join Date
    Oct 2007
    Location
    Rock Island, IL
    Posts
    571
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Pyro View Post
    Yep, those are they. Biggest pitcher I have seen on them was probably 60cm I would guess. Resting on the ground it came up to my daughter's sternum.
    in inches how big is 60 cm...math was never big on me...
    All fear violence, all are afraid of death.
    Seeing the similarity to oneself, one should not use violence or have it used.
    The Buddha
    Facebook: http://www.facebook.com/home.php?ref...r1?ref=profile

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    24" or 2'
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20

    Join Date
    Mar 2007
    Location
    Hamakua Coast,Hawaii,USA
    Posts
    1,235
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Grr I just can't germinate them,sometime when I have room I want to try with fresh seed and great lighting but I already tried that 4 batches
    I most likely need frwsh highlander seed,good lighting and blender lfs.....

  5. #21
    Zero's Avatar
    Join Date
    Aug 2005
    Location
    Dark side of the Moon
    Posts
    1,299
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    some pics of the parents from last year.

    zippo for scale, these are HUGE plants.
    SK-8 OR DIE

    growlist

  6. #22
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow. Those are some massive leaves. I could almost use them as bedsheets.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  7. #23
    Zero's Avatar
    Join Date
    Aug 2005
    Location
    Dark side of the Moon
    Posts
    1,299
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yeah, truncata is large.
    I'm not sure what I'll do with mine.
    It's about 15" across and just starting to put size on.
    I'm running out of room.
    SK-8 OR DIE

    growlist

  8. #24
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Good Lord! Those are like bical leaves, but fatter!

    And I thought just having the large raf and the bical was going to be an issue.

    My trucata is about 10" or so - looks like it's going to be a monster, too.

    Time to think about expanding the indoor hothouse - the wife is NOT going to like that.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 3 of 5 FirstFirst 12345 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •