User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Question

  1. #1

    Join Date
    Jan 2008
    Posts
    29
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Question

    Does anyone no how to sterilise sphagnum moss for seed propagation

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A microwave would work for small batches.

    Get it wet and put it in something like an 8 x 8 Lexan and fire it up for 5 minutes or so and there should be nothing living left.

    That said, sphag tends to be pretty clean in and of itself so...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Zero's Avatar
    Join Date
    Aug 2005
    Location
    Dark side of the Moon
    Posts
    1,299
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    sterilization is bad, it kills off the good bactiria. Try pasturization. What you do is put your moss in a container and add boiling water too it. Let set till room temp and then use it.
    should kill all the bad stuff, leaving the good unharmed.
    peace,
    Zero
    SK-8 OR DIE

    growlist

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ummm... Boiling water is going to kill both good and bad organisms (unless they happen to be thermophiles) since their molecular machinery is the same and therefore susceptible to the same caveats of biology (protein denaturation, DNA melting, etc...)

    http://en.wikipedia.org/wiki/Pasteurization
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    im with Pyro.........boiling or microwave equals the same result...in all actuality both are doing the exact same thing....good bacteria arent any more resilliant than bad..........i dont sterilize LFS for anything
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  6. #6
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I wouldn't worry about sterilization or pasteurization at all for seeding on LFS, just make sure there is very high air circulation and the light intensity is equally high. The only thing you'll have to worry about bothering seeds is usually botrytis and after they germinate, pithium, both of which can be cut down heavily with high air circulation.

  7. #7
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Does microwaving actually sterilize? Rarely do I microwave a pot of media for 20 minutes set on high for some special plants or seed, but I was speaking with someone who grows mushrooms and he said you need an autoclave/pressure cooker to really sterilize something.

  8. #8
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well there is steralized......and than there is steralized for the purposes of sowing seeds a microwave or the like is good enough.......but what most dont seem to realize is steralized media creates a "vaccume" and nature dont like "vaccumes" so as soon as the media cools down to acceptible levels and you place the seeds in it, bacteria from the air and on the seeds themselves start growing and multiplying in the media......boiling water and dumping it over the media or microwaving it should get rid of weed seeds though...which is good
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •